How to correct single nucleotide variation due to PCR bias ?
0
0
Entering edit mode
5 months ago
Gautier • 0

Hello everyone,

I'm having a hard time to find how to merge my data when I have a single nucleotide variation. How can I tell my Rstudio script to merge my data when I have only a single nucleotide variation (that I consider due to a PCR bias amplification of my library) ? I would like to merge the data to rows that have the highest clonal rate, like this :

cloneFraction nSeqCDR3

0.3520491020252197 TGTGCCAGCAGTTTGAATTTAGCGGACGGTGAAGCTTTCTTT 0.0324321742453190 TGCGCCAGCAGTTTGAATTTAGCGGACGGTGAAGCTTTCTTT

so I have :

cloneFraction nSeqCDR3 0.38448.... TGTGCCAGCAGTTTGAATTTAGCGGACGGTGAAGCTTTCTTT

Thank you for your help, I know how to merge but I'm looking on how to tell the script to merge when only one nucleotide is different.

Regards,

datacorrection rstudio nucleotide merge • 127 views
ADD COMMENT

Login before adding your answer.

Traffic: 2284 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6