Problem with obitools (obiconvert a simple fasta to ecopcr)
1
0
Entering edit mode
6 weeks ago
Daniel ▴ 10

Hello all,

After battling for a couple of days with this issue, I still cannot convert a simple fasta file to an ecopcr database. I have tried multiple solutions found in this forum (e.g. Obiconvert produces empty EcoPCR database...why?) as well as following tutorials (https://metabarcoding.org/IMG/html/primerdesign.html ) to no avail.

I have a simple fasta file downloaded from genbank with 10 species of arthropods. What I want to know is if with the specific primers I have, would I be able to amplify these barcodes.

I have followed the instructions available in the biostars solution above (328000), but when I do:

obiaddtaxids, the .fasta file I create is empty.

Similarly, when I follow the primerdesign tutorial:

obiannotate, again the .fasta file I create is empty.

below a sample of my fasta sequences in case anyone can deduce some solution!

>MT357746.1 Folsomia sensibilis voucher JPV-116_Mar_WHE1_150_Folmsen_1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
CCATAGTAGGAACAGCTTTTAGAATGTTAATTCGCCTAGAATTAGGCCAACCTGGATCCTTTATTGGAGA
TGATCAA ......
>MT357672.1 Isotomodes falsus voucher JPV-74_Mar_ARM4_450_Isotfal_2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
GACACTATATTTAGTTTTCGGCGTTTGATCTGCCATAGTAGGAACAGCCTTTAGAGTGTTAATTCGCTTA
GAACTAGGCCAACCTGGCTCTTTTATCGGAGATGACCAAATTTATAATGTGCTAGTAACAGCCCATGCCT
TCATCATAATTTTTTT .....
>KT799636.1 Mesaphorura yosii cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial
AACTCTTTACTTAATTCTAGGGTCATGGTCAGCCATAGTGGGGACCGCCTTTAGTGTATTGATTCGAGTT......

I appreciate your help very much indeed.

daniel

EDIT: Alternatively, if anyone could suggest another way for me to in silico test if the primers I have would amplify the given barcodes I'd be forever in your debt!

obiconvert ecopcr obitools • 134 views
ADD COMMENT
1
Entering edit mode
6 weeks ago
Daniel ▴ 10

For anyone interested, I managed to solve this by downloading everything in genbank format and using that instead of fasta!

ADD COMMENT

Login before adding your answer.

Traffic: 1025 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6