Hello all,
After battling for a couple of days with this issue, I still cannot convert a simple fasta file to an ecopcr database. I have tried multiple solutions found in this forum (e.g. Obiconvert produces empty EcoPCR database...why?) as well as following tutorials (https://metabarcoding.org/IMG/html/primerdesign.html ) to no avail.
I have a simple fasta file downloaded from genbank with 10 species of arthropods. What I want to know is if with the specific primers I have, would I be able to amplify these barcodes.
I have followed the instructions available in the biostars solution above (328000), but when I do:
obiaddtaxids, the .fasta file I create is empty.
Similarly, when I follow the primerdesign tutorial:
obiannotate, again the .fasta file I create is empty.
below a sample of my fasta sequences in case anyone can deduce some solution!
>MT357746.1 Folsomia sensibilis voucher JPV-116_Mar_WHE1_150_Folmsen_1 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
CCATAGTAGGAACAGCTTTTAGAATGTTAATTCGCCTAGAATTAGGCCAACCTGGATCCTTTATTGGAGA
TGATCAA ......
>MT357672.1 Isotomodes falsus voucher JPV-74_Mar_ARM4_450_Isotfal_2 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
GACACTATATTTAGTTTTCGGCGTTTGATCTGCCATAGTAGGAACAGCCTTTAGAGTGTTAATTCGCTTA
GAACTAGGCCAACCTGGCTCTTTTATCGGAGATGACCAAATTTATAATGTGCTAGTAACAGCCCATGCCT
TCATCATAATTTTTTT .....
>KT799636.1 Mesaphorura yosii cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial
AACTCTTTACTTAATTCTAGGGTCATGGTCAGCCATAGTGGGGACCGCCTTTAGTGTATTGATTCGAGTT......
I appreciate your help very much indeed.
daniel
EDIT: Alternatively, if anyone could suggest another way for me to in silico test if the primers I have would amplify the given barcodes I'd be forever in your debt!
I just add "taxid=[the taxid];" in the header. For example in your fasta file:
And then something like