Why Are There Duplicate Refseq Entries Mapping To Identical Genome Locations?
1
0
Entering edit mode
7.1 years ago

I know refseq may duplicate gene IDs if they map to multiple regions on the genome.

This is different - I'm finding duplicates even for genes which map to _identical_ regions on the genome. For example, this query for chr1:77548961-77812107 on the most recent rnor5 genome returns two results:

The two results are exactly identical. Why is this?

>rn5_refGene_NM_001025131 range=chr1:77548961-77812107 5'pad=0 3'pad=0 strand=- repeatMasking=none
tcatgaacttgggcgcacaaatgcagcagaatgttctttgtatgagttca
aattgctcaataaaataatccttgtctctgtgttacaatatttatttatt
cctatcagtagctagtttcacaagagactagagaatgttaatgatttttt
aattgcactataaatcttacctctcagcatttgctataaacagaacaggt
ATGATGTCAGACTATACTTGGTTTGAAGGAATACCTTTTCCTGCCTTTTG
GTTTTCCAAAGAAATTCTGGAAAATAGTTGTAAGAAGTTTGTGGTAAAAG
AAGACGACTTGATCATATTGACTTACCCCAAGTCAGGAACGAACTGGCTG
ATCGAGATTGTCTGCTTGATTCAGACCAAGGGAGATCCCAAGTGGATCCA
ATCTATGCCCATCTGGGATCGCTCACCCTGGATAGAGACTGGTTCAGGAT
ATGATAAATTAACCAAAATGGAAGGACCACGACTCATGACCTCCCATCTT
CCCATGCATCTTTTCTCCAAGTCTCTCTTCAGTTCCAAGGCCAAGGTGAT
ATATCTCATCAGAAATCCCAGAGATGTTCTTGTTTCTGCTTATTTTTTCT
GGAGTAAGATCGCCCTGGAGAAGAAACCAGACTCGCTGGGAACTTACGTT
GAATGGTTCCTCAAAGGAAATGTTGCATATGGATCATGGTTTGAGCACAT
CCGTGGCTGGCTGTCTATGAGAGAATGGGACAACTTCTTGGTACTGTACT
ATGAAGACATGAAAAAGGATACAATGGGATCCATAAAGAAGATATGTGAC
TTCCTGGGGAAAAAATTAGAGCCAGATGAGCTGAATTTGGTCCTCAAGTA
TAGTTCCTTCCAAGTCGTGAAAGAAAACAACATGTCCAATTATAGCCTCA
TGGAGAAGGAACTGATTCTTACTGGTTTTACTTTCATGAGAAAAGGCACA
ACTAATGACTGGAAGAATCACTTCACAGTAGCCCAAGCTGAAGCCTTTGA
TAAAGTGTTCCAGGAGAAAATGGCCGGTTTCCCTCCAGGGATGTTCCCAT
GGGAATAAattgtgaaagtaattttttaaaagatagtattattaatacta
gtagtatcagcggtggtggtggtggtggtggtggtggtggtggtggtggt
ggtggtgggtgtacctttcagtttgtagtgcctttagatgccagaacact
gcactggtactagggacctgcagtttcattaagctgtaaacttcttgctt
tgggtgct
>rn5_refGene_NM_001025131 range=chr1:77548961-77812107 5'pad=0 3'pad=0 strand=- repeatMasking=none
tcatgaacttgggcgcacaaatgcagcagaatgttctttgtatgagttca
aattgctcaataaaataatccttgtctctgtgttacaatatttatttatt
cctatcagtagctagtttcacaagagactagagaatgttaatgatttttt
aattgcactataaatcttacctctcagcatttgctataaacagaacaggt
ATGATGTCAGACTATACTTGGTTTGAAGGAATACCTTTTCCTGCCTTTTG
GTTTTCCAAAGAAATTCTGGAAAATAGTTGTAAGAAGTTTGTGGTAAAAG
AAGACGACTTGATCATATTGACTTACCCCAAGTCAGGAACGAACTGGCTG
ATCGAGATTGTCTGCTTGATTCAGACCAAGGGAGATCCCAAGTGGATCCA
ATCTATGCCCATCTGGGATCGCTCACCCTGGATAGAGACTGGTTCAGGAT
ATGATAAATTAACCAAAATGGAAGGACCACGACTCATGACCTCCCATCTT
CCCATGCATCTTTTCTCCAAGTCTCTCTTCAGTTCCAAGGCCAAGGTGAT
ATATCTCATCAGAAATCCCAGAGATGTTCTTGTTTCTGCTTATTTTTTCT
GGAGTAAGATCGCCCTGGAGAAGAAACCAGACTCGCTGGGAACTTACGTT
GAATGGTTCCTCAAAGGAAATGTTGCATATGGATCATGGTTTGAGCACAT
CCGTGGCTGGCTGTCTATGAGAGAATGGGACAACTTCTTGGTACTGTACT
ATGAAGACATGAAAAAGGATACAATGGGATCCATAAAGAAGATATGTGAC
TTCCTGGGGAAAAAATTAGAGCCAGATGAGCTGAATTTGGTCCTCAAGTA
TAGTTCCTTCCAAGTCGTGAAAGAAAACAACATGTCCAATTATAGCCTCA
TGGAGAAGGAACTGATTCTTACTGGTTTTACTTTCATGAGAAAAGGCACA
ACTAATGACTGGAAGAATCACTTCACAGTAGCCCAAGCTGAAGCCTTTGA
TAAAGTGTTCCAGGAGAAAATGGCCGGTTTCCCTCCAGGGATGTTCCCAT
GGGAATAAattgtgaaagtaattttttaaaagatagtattattaatacta
gtagtatcagcggtggtggtggtggtggtggtggtggtggtggtggtggt
ggtggtgggtgtacctttcagtttgtagtgcctttagatgccagaacact
gcactggtactagggacctgcagtttcattaagctgtaaacttcttgctt
tgggtgct
refseq annotation • 1.6k views
ADD COMMENT
0
Entering edit mode
7.1 years ago
deanna.church ★ 1.1k

This looks like a bug at UCSC- if you view the RefSeq annotation you only see this once: http://tinyurl.com/ngpwts3 I'd recommend reporting this to UCSC to try to find out more.

ADD COMMENT

Login before adding your answer.

Traffic: 1669 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6