gives empty output
Entering edit mode
2.9 years ago
Bane ▴ 30

I have 2 paired end RNA-Seq data and i need to find miRNAs therefore i am using miRDeep2. I installed the miRDeep2 through conda (could not make manual installation). First i am making my index through bowtie by

bowtie-build GCA_018258275.1_ASM1825827v1_genomic.fna index_file

Then i am starting the by SRR1687231_1.fastq -e -h -i -j -k AGATCGGAAGAG -l 21 -m -p index_file -s R_collapsed.fa -t R_refdb.arf -v -o 4

But i consistently getting this result

parsing fastq to fasta format 
converting rna to dna alphabet
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
trimming unmapped nts in the 3' ends
Log file for this run is in mapper_logs and called mapper.log_8642
Mapping statistics

#desc   total   mapped  unmapped    %mapped %unmapped
total: 0    0   0   Illegal division by zero at /home/bane/anaconda3/bin/ line 737.

This is my mapper.log

current dir:    /home/bane/Desktop/Mine_1200TL/miRdeep2
mapper command: /home/bane/anaconda3/bin/ 31_1.fastq -e -h -i -j -k GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC -l 21 -m -p index -s R_collapsed.fa -t R_refdb.arf -v -o 4

timestamp:  16_07_2021_t_21_16_08

parsing fastq to fasta format 31_1.fastq > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads.fa
converting rna to dna alphabet dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads.fa > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_dna.fa
discarding sequences with non-canonical letters dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_dna.fa -b > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_letters.fa 2>dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_discarded.fa
clipping 3' adapters dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_letters.fa GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_clip.fa
discarding short reads dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_clip.fa -a 21 > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_no_short.fa 2>dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_too_short
collapsing reads dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_no_short.fa seq > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_nr.fa
mapping reads to genome index
bowtie -p 4 -f -n 0 -e 80 -l 18 -a -m 5 --best --strata  index  --al dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/31_1.fastq_mapped --un dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/31_1.fastq_not_mapped  dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/reads_nr.fa dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.bwt 2>bowtie.log dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.bwt > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.arf
trimming unmapped nts in the 3' ends dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings.arf -j > dir_mapper_seq_31_1.fastq_4654439749_16_07_2021_t_21_16_08/mappings_trim.arf

remove tmp dir


I can not figure out the problem. Can anyone help me with this problem? By the way this is my first attempt of miRNA

miRDeep2 Bowtie • 1.7k views
Entering edit mode

Why don't you ask on their GitHub-page

Entering edit mode

To be honest i did not know that was an option and i just checked their GitHub-page and Drmirdeep (contributor of the tool) seems a bit angry and offensive to the people who asks questions.

Well i will try my chance anyway

Entering edit mode

Did you run one of the tutorials? Just to be sure that is not an installation poblem

Entering edit mode

actually it did not. the tool has to create a result.html file but it simply didnt. bowtie results seems fine though. when i try my bowtie has %0 allignment but this one has %56. I dont know what is wrong with the tool

Entering edit mode

i just ran the tutorial again with different files and it worked perfectly. I think the problem related with bowtie. I am creating the index file with bowtie version 1.0 and running the with the same bowtie (i mean i suppose it is the same because conda installed everything just with mirdeep2) but it does not allign anything

Entering edit mode

Why do you think they are being offensive?


Login before adding your answer.

Traffic: 2894 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6