Annotating variants from a sequence and list of position-specific variants
0
0
Entering edit mode
3 months ago
manaswwm ▴ 170

Hello all,

I have a list of sequences and for every sequence there is a corresponding table that contains position-specific variants. To give you an example:

Here is a sequence:

>seq1
ATGGAGGATCAAGTTGGGTTTGGGTTCCGTCCGAACGACGAGGAGCTCGTTGGTCACTATCTCCGTAACAAAATCGAAGGAAACACTA

And here is the corresponding variation information:

position  variant_allele
11            C
12            G
18            A

Does anyone know of any straightforward tool (preferably a package in R) which can annotate these variants (whether the variant is synonymous/non-synonymous). I do not use/convert this information into a vcf file at any stage. Any help is appreciated!

variant-effect-predictor variant-annotation vep • 93 views
ADD COMMENT

Login before adding your answer.

Traffic: 2643 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6