Hi,
I have a query regarding reads assembly I have a bam file I made a consensus sequence but I want to make a consensus sequence with a minimum of 2 coverage per site instead of full coverage I want to compare substitution changes but only I found full coverage is only in my consensus sequence.
I want to extract If at minimum 2-3 read mapping l particular nucleotide, this nucleotide is retrieved in a consensus.
I have used the following command to make a consensus can we specify minimum coverage per site
samtools mpileup -uf ref.fasta myfile_sorted.bam | bcftools call -c | vcfutils.pl vcf2fq > cons.fq
conse. ATGACGACTCCGTTCCACTCGTGGCTGCTTCTTTTGATATTGTTGCTGCCATTTGTTGTTGCTCCAACGCTATAGTTGTTGTTGTTGTTGTGGTCAACAAAATGGGAGTTGTTGttgcaaatgggagaag ref ATGACGACTCCGTTCCACTCGTGGCTGCTTCTTTTGATATTGTTGCTGCCATTTGTTGTTGCTCCAACGCTATTGTTGTTGTTGTTGTTGTGGTCAACAAAATGGGAGTTGTTGTTGCAAATGGGAGAAGTGCAGCTGTTGCAGCCGTAA
kindly guide me
