Insert SNPs in FASTA sequence given position file

Question

[Emilio Marmol]

I have a FASTA file in which I would like to introduce some N point mutations for further analyses, given afile with their positions in the corresponding sequences.

The FASTA file:

>ref1
AATGGTGCGGCGAGAGCCGCAGATTTGAGAGCC
>ref2
AAAAAATTTTTATCTCTCTTGGGCCCCGATAGACTCCGGGCCGA

And the position file, with TABS as delimiter:

ref1   10    G    N  
ref1   13    A    N
ref1   20    C    N
ref2    3    A    N
ref2   15    T    N

The desired output would be another FASTA file with the N mutations added in their corresponding places.

>ref1
AATGGTGCGNCGNGAGCCGNAGATTTGAGAGCC
>ref2
AANAAATTTTTATCNCTCTTGGGCCCCGATAGACTCCGGGCCGA

I have tried using bcftools consensus building a dummy vcf structure from my positioning file, but it seems to be not working as it requires a true vcf header with info I cannot properly recreate...

Do you know of any other alternative wat to do this task with other online tools or manually via scripting??

I guess some python/awk/bash scripting might be able to get it done but I am not quite fluent enough on python to develop such a script...

Many thanks.

[Pierre Lindenbaum]

it requires a true vcf header with info I cannot properly recreate.

what's the problem here ? one need a few standard header lines, and adding a few columns

[Emilio Marmol]

I tried several headers but none of them seemed to work... there was always an issue or another and ended up in a parsing error.

[Pierre Lindenbaum]

show us your code....