GUIDEseq unsupported operand type(s)
0
0
Entering edit mode
8 weeks ago
17318598206 ▴ 10

I am having this problem using the SAM file to identify the off-target

$python /home/data/vip55/software/guideseq-master/guideseq/guideseq.py identify --aligned G2-1_S3_L004_R1_001.sam --genome /home/data/vip55/index/hg38/GRCh38.p13.genome.fa --outfolder ~/1work/guide-seq/L1-1-G4-2-0.5lane --target_sequence AGCCCCAGCAAGAGCACAAGAGG --description G2-1_S3_L004_R1_001

[09/26 05:23:50PM][INFO][guideseq] Identifying offtarget sites... [09/26 05:23:50PM][INFO][identifyOfftargetSites] Processing SAM file G2-1_S3_L004_R1_001.sam [09/26 05:23:50PM][ERROR][guideseq] Error identifying offtarget sites. [09/26 05:23:50PM][ERROR][guideseq] Traceback (most recent call last): File "/home/data/vip55/software/guideseq-master/guideseq/guideseq.py", line 222, in identifyOfftargetSites identifyOfftargetSites.analyze(samfile, self.reference_genome, self.identified[sample], annotations) File "/home/data/vip55/software/guideseq-master/guideseq/identifyOfftargetSites.py", line 217, in analyze chromosome_position.addPositionBarcode(chromosome, read_position, strand, barcode, primer, count) File "/home/data/vip55/software/guideseq-master/guideseq/identifyOfftargetSites.py", line 66, in addPositionBarcode self.chromosome_barcode_dict[chromosome][position][strand][barcode] += count TypeError: unsupported operand type(s) for +=: 'int' and 'NoneType'

Do you know what can be the problem? I did not use the UMI and started from "align" step

Thanks a lot for youtr time

GUIDEseq • 94 views
ADD COMMENT

Login before adding your answer.

Traffic: 1064 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6