question regarding sequencing alignment
0
0
Entering edit mode
9 weeks ago
Lin ▴ 30

Hi Everyone,

As it turns out, I don't understand how alignment works. I am hoping someone can help me understand it better. I have a custom genome assembly that I aligned to hg38. Zooming into a particular region, I see 3 alignments:

IGV alignments

I tried to search for this particular sequences "TCAATTTTGAAATCTGCAAAGTATTCATTA" in my genome assembly fasta that shows coverage of 3 using blast. I was expecting to have 3 matches but then it only returns 2 matches.

I am confused. I was expecting the search to return 3 matches since there are 3 alignments.

Can anyone please help me understand why it only returns 2 matches instead of 3?

Thank you in advance for your help!

blast result:

Database: scaffolds_FINAL.fasta
           99 sequences; 2,916,671,763 total letters



Query= > test2

Length=30
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

scaffold_8                                                            56.5    2e-07


>scaffold_8
Length=141881116

 Score = 56.5 bits (30),  Expect = 2e-07
 Identities = 30/30 (100%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  1        TCAATTTTGAAATCTGCAAAGTATTCATTA  30
                ||||||||||||||||||||||||||||||
Sbjct  7937684  TCAATTTTGAAATCTGCAAAGTATTCATTA  7937713


 Score = 56.5 bits (30),  Expect = 2e-07
 Identities = 30/30 (100%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  1        TCAATTTTGAAATCTGCAAAGTATTCATTA  30
                ||||||||||||||||||||||||||||||
Sbjct  8007698  TCAATTTTGAAATCTGCAAAGTATTCATTA  8007727



Lambda      K        H
    1.33    0.621     1.12

Gapped
Lambda      K        H
    1.28    0.460    0.850

Effective search space used: 17500016322


  Database: scaffolds_FINAL.fasta
    Posted date:  Nov 29, 2022  1:21 PM
  Number of letters in database: 2,916,671,763
  Number of sequences in database:  99



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5

first few lines of 1st alignment:

Read name = scaffold_8
Read length = 19,508bp
Flags = 2048
----------------------
Mapping = Supplementary @ MAPQ 60
Reference span = chr11:128,797,610-128,817,807 (+) = 20,198bp
Cigar = 7922472H5518M1D5597M1D4095M693D979M5I3314M133939136H
Clipping = Left 7,922,472 hard; Right 133,939,136 hard
----------------------
SupplementaryAlignments
chr11:28,991,342-34,686,692 (-) = 5,695,350bp @MAPQ 60 NM16125
chr11:122,017,398-126,863,398 (-) = 4,846,000bp @MAPQ 60 NM23032

2nd alignment:

Read name = scaffold_8
Read length = 70,350bp
Flags = 2048
----------------------
Mapping = Supplementary @ MAPQ 60
Reference span = chr11:128,797,772-128,868,092 (+) = 70,321bp
Cigar = 7991953H30938M1I266M1I222M1D6885M10I13988M1I6162M16I7841M1I4018M133818813H
Clipping = Left 7,991,953 hard; Right 133,818,813 hard
----------------------
SupplementaryAlignments
chr11:28,991,342-34,686,692 (-) = 5,695,350bp @MAPQ 60 NM16125
chr11:122,017,398-126,863,398 (-) = 4,846,000bp @MAPQ 60 NM23032

3rd alignment:

Read name = scaffold_8
Read length = 53,770bp
Flags = 2048
----------------------
Mapping = Supplementary @ MAPQ 60
Reference span = chr11:128,813,516-128,867,266 (+) = 53,751bp
Cigar = 7937683H978M5I3600M3D1673M4D6130M11I2806M1I488M1D1197M1I5688M11I2540M3I9687M1D13790M1I1973M6D484M1I2702M133889663H
Clipping = Left 7,937,683 hard; Right 133,889,663 hard
----------------------
SupplementaryAlignments
chr11:28,991,342-34,686,692 (-) = 5,695,350bp @MAPQ 60 NM16125
chr11:122,017,398-126,863,398 (-) = 4,846,000bp @MAPQ 60 NM23032
alignment read sequence • 163 views
ADD COMMENT

Login before adding your answer.

Traffic: 2015 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6