Entering edit mode
2.3 years ago
kuttibiotech2009
▴
30
Respected all,
I am working with miRNA data. Currently, I am facing the following issues in the genome.fa file. Please look at it and give your valuable comments to solve the error
Thanks
Error: problem with genome.fa Error in line 6.618: The sequence
TCAAATACTGAAAAATATTTCACAGCATTCTCATATTTGTGGTGAATTTTCAGAAGCTTR
contains characters others than [acgtnACGTN]
Please check your file for the following issues:
I. Sequences are allowed only to comprise characters [ACGTNacgtn]. II. Identifiers are not allowed to have withespaces.
Hello jack Tierney Thanks for your comment.. After replacing N with R it's working fine... I have posted another one question...please look at it and give your suggestions it will help me a lot