show amplicon like exon in UCSC/IGV
0
0
Entering edit mode
12 months ago
Sara ▴ 10

Hello

How I can show these probes like exons in UCSC/IGV? I mean I want each pair of probes linked together with a line and flesh showing its strand.

Target ID ULSO Sequence DLSO Sequence Gene ID

OBRA_BRCA2_1 TTTTACCTACGATATTCCTCCAATG TCAGAAGCGCTGGAAAATTTGTTTG BRCA2

OBRA_BRCA2_2 GCAGCGTGTCTTAAAAATTTCAAAA ACTTACACAGGGATGCATTCCTTAT BRCA2

Thanks Sara

amplicon • 246 views
ADD COMMENT

Login before adding your answer.

Traffic: 2068 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6