Can PHG handle spanning deletions in GVCF genotypes?
8
0
Entering edit mode
16 months ago
matt.shenton ▴ 40

Dear PHG team,

Many thanks for your continued help.

I'm elevating this to it's own post, it seems to be a separate problem to my previous issue.

If I create haplotypes from gvcfs that were created my mapping short reads against a reference, I can build the DB OK.

However, when I try to create a vcf by imputation from NGS short read data in fastq files, i get an error

java.lang.IllegalStateException: Allele in genotype ACCACTGCCGGATCTGGAGGCCGGGCCACCGCCGCCGCCCCTG not in the variant context [A*, G]

It seems to be when there is a spanning deletion (coded as *) in the VCF, and my genotype is 2/2 (for example).

Should the PHG be able to handle this? Or do I need to filter all such positions when creating haplotypes from short-read derived gvcfs?

Many thanks for your help,

Matt Shenton

My previous comment about this issue

PHG • 1.5k views
ADD COMMENT
0
Entering edit mode

Matt - thanks for creating a new post for this. That makes it clearer to see the issue. We are looking at this and will get back to you. Will you post the command you are running and the log file to this posting so we have it in 1 place? Thank you.

ADD REPLY
0
Entering edit mode

Thanks again for looking at this.

I uploaded the test db to my google drive, so if it is helpful you can take a look. The log files and gvcf files are included.

config file for initial DB construction was DBconfig.txt

config file for adding haplotypes was gvcfcontig.txt

config files for CreateConsensi was consensusconfig0.001.txt and consensusconfig0.txt

config file for imputation was imputation_config_rc8401_CONSENSUS0accessions_11_20_20230228.txt

link to tar.gz of test db

ADD REPLY
0
Entering edit mode

(the tar.gz archive is about 5Gb)

ADD REPLY
0
Entering edit mode
16 months ago

Many thanks for your reply.

Here are the commands:

WORKDIR=~/analysis/PHGsingularity/testrc

SINGULARITY_CONFIG_FILE=/phg/imputation_config_rc8401_CONSENSUS0accessions_11_20.txt

sudo singularity exec -B ${WORKDIR}:/phg/ /home/mshenton/analysis/PHGsingularity/phg1.3.simg /tassel-5-standalone/run_pipeline.pl -Xmx20G -debug -configParameters ${SINGULARITY_CONFIG_FILE} -ImputePipelinePlugin -imputeTarget pathToVCF -endPlugin > imputelog20230219.log

ADD COMMENT
0
Entering edit mode
16 months ago

/tassel-5-standalone/lib/ahocorasick-0.2.4.jar:/tassel-5-standalone/lib/biojava-alignment-6.0.4.jar:/tassel-5-standalone/lib/biojava-core-6.0.4.jar:/tassel-5-st andalone/lib/biojava-genome-6.0.4.jar:/tassel-5-standalone/lib/biojava-phylo-4.2.12.jar:/tassel-5-standalone/lib/colt-1.2.0.jar:/tassel-5-standalone/lib/commons -codec-1.10.jar:/tassel-5-standalone/lib/commons-io-2.11.0.jar:/tassel-5-standalone/lib/commons-math3-3.4.1.jar:/tassel-5-standalone/lib/ejml-core-0.41.jar:/tas sel-5-standalone/lib/ejml-ddense-0.41.jar:/tassel-5-standalone/lib/fastutil-8.2.2.jar:/tassel-5-standalone/lib/forester-1.039.jar:/tassel-5-standalone/lib/gs-co re-1.3.jar:/tassel-5-standalone/lib/gs-ui-1.3.jar:/tassel-5-standalone/lib/guava-22.0.jar:/tassel-5-standalone/lib/htsjdk-2.24.1.jar:/tassel-5-standalone/lib/in i4j-0.5.4.jar:/tassel-5-standalone/lib/itextpdf-5.1.0.jar:/tassel-5-standalone/lib/jackson-annotations-2.13.2.jar:/tassel-5-standalone/lib/jackson-core-2.13.2.j ar:/tassel-5-standalone/lib/jackson-databind-2.13.2.2.jar:/tassel-5-standalone/lib/jackson-module-kotlin-2.13.2.jar:/tassel-5-standalone/lib/javax.json-1.0.4.ja r:/tassel-5-standalone/lib/jcommon-1.0.23.jar:/tassel-5-standalone/lib/jfreechart-1.0.19.jar:/tassel-5-standalone/lib/jfreesvg-3.2.jar:/tassel-5-standalone/lib/ jhdf5-14.12.5.jar:/tassel-5-standalone/lib/json-simple-1.1.1.jar:/tassel-5-standalone/lib/junit-4.10.jar:/tassel-5-standalone/lib/kotlin-reflect-1.6.10.jar:/tas sel-5-standalone/lib/kotlin-stdlib-1.6.10.jar:/tassel-5-standalone/lib/kotlin-stdlib-jdk7-1.6.10.jar:/tassel-5-standalone/lib/kotlin-stdlib-jdk8-1.6.10.jar:/tas sel-5-standalone/lib/kotlinx-coroutines-core-jvm-1.6.0.jar:/tassel-5-standalone/lib/log4j-1.2.13.jar:/tassel-5-standalone/lib/mail-1.4.jar:/tassel-5-standalone/ lib/phg.jar:/tassel-5-standalone/lib/postgresql-9.4-1201.jdbc41.jar:/tassel-5-standalone/lib/scala-library-2.10.1.jar:/tassel-5-standalone/lib/slf4j-api-1.7.10. jar:/tassel-5-standalone/lib/slf4j-simple-1.7.10.jar:/tassel-5-standalone/lib/snappy-java-1.1.8.4.jar:/tassel-5-standalone/lib/sqlite-jdbc-3.39.2.1.jar:/tassel- 5-standalone/lib/sshj-0.32.0.jar:/tassel-5-standalone/lib/trove-3.0.3.jar:/tassel-5-standalone/sTASSEL.jar Memory Settings: -Xms512m -Xmx20G Tassel Pipeline Arguments: -debug -configParameters /phg/imputation_config_rc8401_CONSENSUS0accessions_11_20.txt -ImputePipelinePlugin -imputeTarget pathToVCF - endPlugin [main] INFO net.maizegenetics.plugindef.ParameterCache - load: loading parameter cache with: /phg/imputation_config_rc8401_CONSENSUS0accessions_11_20.txt [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: DBtype value: sqlite [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: maxSecondary value: 20 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: maxParents value: 1000000 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: host value: localHost [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: minTransitionProb value: 0.001 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: DB value: /phg/rc_small_db.db [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: inputType value: fastq [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: pangenomeDir value: /phg/outputDir/pangenome [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: outputSecondaryStats value: false [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: maxNodes value: 1000 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: samDir value: /phg/inputDir/imputation/sam/ [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: fParameter value: f1000,5000 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: minimapLocation value: minimap2 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: numThreads value: 3 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: pathMethod value: rc84010x [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: probCorrect value: 0.99 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: indexNumberBases value: 90G [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: pangenomeHaplotypeMethod value: CONSENSUS0_20 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: minTaxa value: 1 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: indexKmerLength value: 21 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: usebf value: false [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: removeEqual value: true [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: pathHaplotypeMethod value: CONSENSUS0_20 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: minReads value: 1 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: keyFile value: /phg/readMapping_key_file_rc8401.txt [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: user value: sqlite [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: lowMemMode value: true [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: password value: sqlite [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: splitNodes value: true [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: outVcfFile value: /phg/rc8401_0.vcf [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: maxReads value: 10000 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: maxRefRangeErr value: 0.25 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: maxReadsKB value: 100 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: indexWindowSize value: 11 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: maxHap value: 11 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: minP value: 0.8

ADD COMMENT
0
Entering edit mode
16 months ago

[main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: splitProb value: 0.99 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: fastqDir value: /phg/inputDir/imputation/fastq/ [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: readMethod value: FASTQ_0_8401_11_20 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: minCoverage value: 1.0 [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: algorithmType value: efficient [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: configFile value: /phg/imputation_config_rc8401_CONSENSUS0accessions_11_20.txt [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: liquibaseOutdir value: /phg/outputDir [main] INFO net.maizegenetics.plugindef.ParameterCache - ParameterCache: key: localGVCFFolder value: /phg/inputDir/loadDB/gvcf [main] INFO net.maizegenetics.tassel.TasselLogging - Tassel Version: 5.2.87 Date: January 10, 2023 [main] INFO net.maizegenetics.tassel.TasselLogging - Max Available Memory Reported by JVM: 18204 MB [main] INFO net.maizegenetics.tassel.TasselLogging - Java Version: 1.8.0_242 [main] INFO net.maizegenetics.tassel.TasselLogging - OS: Linux [main] INFO net.maizegenetics.tassel.TasselLogging - Number of Processors: 8 [main] INFO net.maizegenetics.pipeline.TasselPipeline - Tassel Pipeline Arguments: [-fork1, -ImputePipelinePlugin, -imputeTarget, pathToVCF, -endPlugin, -runfork1] net.maizegenetics.pangenome.pipeline.ImputePipelinePlugin [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Starting net.maizegenetics.pangenome.pipeline.ImputePipelinePlugin: time: Feb 19, 2023 5:27:26 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - ImputePipelinePlugin Parameters imputeTarget: pathToVCF inputType: fastq configFile: /phg/imputation_config_rc8401_CONSENSUS0accessions_11_20.txt pangenomeHaplotypeMethod: CONSENSUS0_20 pathHaplotypeMethod: CONSENSUS0_20 pangenomeDir: /phg/outputDir/pangenome pangenomeIndexName: null indexKmerLength: 21 indexWindowSize: 11 indexNumberBases: 90G minimapLocation: minimap2 readMethod: FASTQ_0_8401_11_20 readMethodDescription: null outVcfFile: /phg/rc8401_0.vcf forceDBUpdate: false liquibaseOutdir: /phg/outputDir skipLiquibaseCheck: false localGVCFFolder: /phg/inputDir/loadDB/gvcf

ADD COMMENT
0
Entering edit mode
16 months ago

[pool-1-thread-1] INFO net.maizegenetics.pangenome.pipeline.ImputePipelinePlugin - Checking if Liquibase can be run. [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Starting net.maizegenetics.pangenome.liquibase.CheckDBVersionPlugin: time: Feb 19, 2023 5:27:26 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - CheckDBVersionPlugin Parameters outputDir: /phg/outputDir

[pool-1-thread-1] INFO net.maizegenetics.pangenome.liquibase.CheckDBVersionPlugin - Deleting yesFile /phg/outputDir/run_yes.txt if it exists [pool-1-thread-1] INFO net.maizegenetics.pangenome.liquibase.CheckDBVersionPlugin - Deleting noFile /phg/outputDirrun_no.txt if it exists [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - first connection: dbName from config file = /phg/rc_small_db.db host: localHost user: sqlite type: sqlite [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - Database URL: jdbc:sqlite:/phg/rc_small_db.db [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - Connected to database:

[pool-1-thread-1] INFO net.maizegenetics.pangenome.liquibase.CheckDBVersionPlugin - queueHaplotypeNodesByRange: query: select name FROM sqlite_master where type='table' and name='variants'; [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Finished net.maizegenetics.pangenome.liquibase.CheckDBVersionPlugin: time: Feb 19, 2023 5:27:26 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - net.maizegenetics.pangenome.liquibase.CheckDBVersionPlugin Citation: Bradbury PJ, Zhang Z, Kroon DE, Casstevens TM, Ramdoss Y, Buckler ES. (2007) TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics 23:2633-2635. [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Starting net.maizegenetics.pangenome.liquibase.LiquibaseUpdatePlugin: time: Feb 19, 2023 5:27:26 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - LiquibaseUpdatePlugin Parameters outputDir: /phg/outputDir command: status

[pool-1-thread-1] INFO net.maizegenetics.pangenome.liquibase.LiquibaseUpdatePlugin - Please wait, begin Command:liquibase --driver=org.sqlite.JDBC --url=jdbc:sqlite:/phg/rc_small_db.db --username=sqlite --password=sqlite --changeLogFile=changelogs/db.changelog-master.xml status --verbose [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Finished net.maizegenetics.pangenome.liquibase.LiquibaseUpdatePlugin: time: Feb 19, 2023 5:27:28 [pool-1-thread-1] INFO net.maizegenetics.pangenome.pipeline.ImputePipelinePlugin - PHG DB is up to date. Proceeding with Populating the PHG DB. [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Starting net.maizegenetics.pangenome.api.HaplotypeGraphBuilderPlugin: time: Feb 19, 2023 5:27:28 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - HaplotypeGraphBuilderPlugin Parameters configFile: /phg/imputation_config_rc8401_CONSENSUS0accessions_11_20.txt methods: CONSENSUS0_20 includeSequences: true includeVariantContexts: false haplotypeIds: null chromosomes: null taxa: null localGVCFFolder: /phg/inputDir/loadDB/gvcf

ADD COMMENT
0
Entering edit mode
16 months ago


[pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - 23 ranges had too few reads; 0 ranges had too many reads; 0 ranges had all reads equal [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - Finding path for chromosome 10 using ViterbiOneGametePerNode [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - Finished processing reads for a sample: 40 ranges discarded out of 53. [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - 40 ranges had too few reads; 0 ranges had too many reads; 0 ranges had all reads equal [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - Finding path for chromosome 11 using ViterbiOneGametePerNode [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - Finished processing reads for a sample: 56 ranges discarded out of 76. [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - 56 ranges had too few reads; 0 ranges had too many reads; 0 ranges had all reads equal [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - Finding path for chromosome 12 using ViterbiOneGametePerNode [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - Finished processing reads for a sample: 71 ranges discarded out of 91. [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathFinderForSingleTaxonNodes - 71 ranges had too few reads; 0 ranges had too many reads; 0 ranges had all reads equal [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.BestHaplotypePathPlugin - found path for 8401 in 65 ms [pool-1-thread-1] DEBUG net.maizegenetics.pangenome.db_loading.DBLoadingUtils - encodePathARrayFromSet: Extracting the haplotypeIds [pool-1-thread-1] DEBUG net.maizegenetics.pangenome.db_loading.DBLoadingUtils - encodePathArrayFromSet: created the compressed path data [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.PHGdbAccess - PHGdbAccess:putMethod: added method rc84010x to methods table [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.PHGdbAccess - before loading hash, size of all methods in method table=12 [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.PHGdbAccess - putPathsData - total count loaded to read_mapping_paths table: 1 [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.PHGdbAccess - Closing DB [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Finished net.maizegenetics.pangenome.hapCalling.BestHaplotypePathPlugin: time: Feb 19, 2023 5:27:33 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Starting net.maizegenetics.pangenome.api.HaplotypeGraphBuilderPlugin: time: Feb 19, 2023 5:27:33 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin -

ADD COMMENT
0
Entering edit mode
16 months ago

[pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - HaplotypeGraphBuilderPlugin Parameters configFile: /phg/imputation_config_rc8401_CONSENSUS0accessions_11_20.txt methods: CONSENSUS0_20 includeSequences: false includeVariantContexts: true haplotypeIds: null chromosomes: null taxa: null localGVCFFolder: /phg/inputDir/loadDB/gvcf

[pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - first connection: dbName from config file = /phg/rc_small_db.db host: localHost user: sqlite type: sqlite [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - Database URL: jdbc:sqlite:/phg/rc_small_db.db [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - Connected to database:

[pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - referenceRangesAsMap: query statement: select reference_ranges.ref_range_id, chrom, range_start, range_end, methods.name from reference_ranges INNER JOIN ref_range_ref_range_method on ref_range_ref_range_method.ref_range_id=reference_ranges.ref_range_id INNER JOIN methods on ref_range_ref_range_method.method_id = methods.method_id AND methods.method_type = 7 ORDER BY reference_ranges.ref_range_id methods size: 1 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - referenceRangesAsMap: number of reference ranges: 1000 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - referenceRangesAsMap: time: 0.008784539 secs. [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - taxaListMap: query statement: SELECT gamete_haplotypes.gamete_grp_id, genotypes.line_name FROM gamete_haplotypes INNER JOIN gametes ON gamete_haplotypes.gameteid = gametes.gameteid INNER JOIN genotypes on gametes.genoid = genotypes.genoid ORDER BY gamete_haplotypes.gamete_grp_id; [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - taxaListMap: number of taxa lists: 479 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - taxaListMap: time: 0.009193037 secs. [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - createHaplotypeNodes: haplotype method: CONSENSUS0_20 range group method: null [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - createHaplotypeNodes: query statement: SELECT haplotypes_id, gamete_grp_id, haplotypes.ref_range_id, asm_contig, asm_start_coordinate, asm_end_coordinate, asm_strand, genome_file_id, seq_hash, seq_len... [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - CreateGraphUtils:addNodes - query=SELECT haplotypes_id, gamete_grp_id, haplotypes.ref_range_id, asm_contig, asm_start_coordinate, asm_end_coordinate, asm_strand, genome_file_id, seq_hash, seq_len, gvcf_file_id FROM haplotypes WHERE method_id = 10; [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - addNodes: number of nodes: 3362 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - addNodes: number of reference ranges: 932 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - createHaplotypeNodes: time: 0.024453876 secs. [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.HaplotypeGraph - Created graph edges: created when requested number of nodes: 3362 number of reference ranges: 932 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Finished net.maizegenetics.pangenome.api.HaplotypeGraphBuilderPlugin: time: Feb 19, 2023 5:27:33 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Starting net.maizegenetics.pangenome.hapCalling.ImportDiploidPathPlugin: time: Feb 19, 2023 5:27:33 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - ImportDiploidPathPlugin Parameters pathMethodName: rc84010x taxa: null

[pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - first connection: dbName from config file = /phg/rc_small_db.db host: localHost user: sqlite type: sqlite [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - Database URL: jdbc:sqlite:/phg/rc_small_db.db

ADD COMMENT
0
Entering edit mode
16 months ago

[pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - Connected to database:

[pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - referenceRangesAsMap: query statement: select reference_ranges.ref_range_id, chrom, ra nge_start, range_end, methods.name from reference_ranges INNER JOIN ref_range_ref_range_method on ref_range_ref_range_method.ref_range_id=reference_ranges.ref_ range_id INNER JOIN methods on ref_range_ref_range_method.method_id = methods.method_id AND methods.method_type = 7 ORDER BY reference_ranges.ref_range_id methods size: 1 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - referenceRangesAsMap: number of reference ranges: 1000 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - referenceRangesAsMap: time: 0.008784539 secs. [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - taxaListMap: query statement: SELECT gamete_haplotypes.gamete_grp_id, genotypes.line_n ame FROM gamete_haplotypes INNER JOIN gametes ON gamete_haplotypes.gameteid = gametes.gameteid INNER JOIN genotypes on gametes.genoid = genotypes.genoid ORDER B Y gamete_haplotypes.gamete_grp_id; [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - taxaListMap: number of taxa lists: 479 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - taxaListMap: time: 0.009193037 secs. [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - createHaplotypeNodes: haplotype method: CONSENSUS0_20 range group method: null [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - createHaplotypeNodes: query statement: SELECT haplotypes_id, gamete_grp_id, haplotypes .ref_range_id, asm_contig, asm_start_coordinate, asm_end_coordinate, asm_strand, genome_file_id, seq_hash, seq_len... [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - CreateGraphUtils:addNodes - query=SELECT haplotypes_id, gamete_grp_id, haplotypes.ref_ range_id, asm_contig, asm_start_coordinate, asm_end_coordinate, asm_strand, genome_file_id, seq_hash, seq_len, gvcf_file_id FROM haplotypes WHERE method_id = 10 ; [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - addNodes: number of nodes: 3362 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - addNodes: number of reference ranges: 932 [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.CreateGraphUtils - createHaplotypeNodes: time: 0.024453876 secs. [pool-1-thread-1] INFO net.maizegenetics.pangenome.api.HaplotypeGraph - Created graph edges: created when requested number of nodes: 3362 number of reference ranges: 932 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Finished net.maizegenetics.pangenome.api.HaplotypeGraphBuilderPlugin: time: Feb 19, 2023 5:2 7:33 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Starting net.maizegenetics.pangenome.hapCalling.ImportDiploidPathPlugin: time: Feb 19, 2023 5:27:33 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - ImportDiploidPathPlugin Parameters pathMethodName: rc84010x taxa: null

[pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - first connection: dbName from config file = /phg/rc_small_db.db host: localHost user: sqlite type: sqlite [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - Database URL: jdbc:sqlite:/phg/rc_small_db.db [pool-1-thread-1] INFO net.maizegenetics.pangenome.db_loading.DBLoadingUtils - Connected to database:

[pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.ImportDiploidPathPlugin - importPathsFromDB: query: SELECT line_name, paths_data FROM paths, genotypes, methods WHERE paths.genoid=genotypes.genoid AND methods.method_id=paths.method_id AND methods.name IN ('rc84010x') [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.ImportDiploidPathPlugin - importPathsFromDB: number of path list: 1 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Finished net.maizegenetics.pangenome.hapCalling.ImportDiploidPathPlugin: time: Feb 19, 2023 5:27:33 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Starting net.maizegenetics.pangenome.hapCalling.PathsToVCFPlugin: time: Feb 19, 2023 5:27:33 [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - PathsToVCFPlugin Parameters outputFile: /phg/rc8401_0.vcf refRangeFileVCF: null

ADD COMMENT
0
Entering edit mode
16 months ago

makeDiploid: true positions: null

[pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathsToVCFPlugin - PathsToVCFPlugin: processData: number of ranges: 932 [pool-1-thread-1] INFO net.maizegenetics.pangenome.hapCalling.PathsToVCFPlugin - PathsToVCFPlugin: processData: number of taxa: 1 [pool-1-thread-1] DEBUG net.maizegenetics.plugindef.AbstractPlugin - Allele in genotype ACCACTGCCGGATCTGGAGGCCGGGCCACCGCCGCCGCCCCTG not in the variant context [A, G] java.lang.IllegalStateException: Allele in genotype ACCACTGCCGGATCTGGAGGCCGGGCCACCGCCGCCGCCCCTG not in the variant context [A, G] at htsjdk.variant.variantcontext.VariantContext$Validation.validateGenotypes(VariantContext.java:382) at htsjdk.variant.variantcontext.VariantContext$Validation.access$200(VariantContext.java:323) at htsjdk.variant.variantcontext.VariantContext$Validation$2.validate(VariantContext.java:331) at htsjdk.variant.variantcontext.VariantContext.lambda$validate$0(VariantContext.java:1384) at java.lang.Iterable.forEach(Iterable.java:75) at htsjdk.variant.variantcontext.VariantContext.validate(VariantContext.java:1384) at htsjdk.variant.variantcontext.VariantContext.<init>(VariantContext.java:489) at htsjdk.variant.variantcontext.VariantContextBuilder.make(VariantContextBuilder.java:647) at htsjdk.variant.variantcontext.VariantContextBuilder.make(VariantContextBuilder.java:638) at net.maizegenetics.pangenome.hapCalling.PathsToVCFPlugin.createVariantContext$phg(PathsToVCFPlugin.kt:406) at net.maizegenetics.pangenome.hapCalling.PathsToVCFPlugin.variantContexts(PathsToVCFPlugin.kt:555) at net.maizegenetics.pangenome.hapCalling.PathsToVCFPlugin$infosByRange$2$1$1.invokeSuspend(PathsToVCFPlugin.kt:238) at kotlin.coroutines.jvm.internal.BaseContinuationImpl.resumeWith(ContinuationImpl.kt:33) at kotlinx.coroutines.DispatchedTask.run(DispatchedTask.kt:106) at kotlinx.coroutines.scheduling.CoroutineScheduler.runSafely(CoroutineScheduler.kt:571) at kotlinx.coroutines.scheduling.CoroutineScheduler$Worker.executeTask(CoroutineScheduler.kt:750) at kotlinx.coroutines.scheduling.CoroutineScheduler$Worker.runWorker(CoroutineScheduler.kt:678) at kotlinx.coroutines.scheduling.CoroutineScheduler$Worker.run(CoroutineScheduler.kt:665) [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Usage: PathsToVCFPlugin <options> -outputFile <Output VCF File Name> : Output file name (required) -refRangeFileVCF <Reference Range File> : Reference Range file used to subset the paths for only specified regions of the genome. -referenceFasta <Reference Genome> : Reference Genome. -makeDiploid <true | false> : Whether to report haploid paths as homozygousdiploid (Default: true) -positions <Position List> : Positions to include in VCF. Can be specified by Genotype file (i.e. VCF, Hapmap, etc.), bed file, or json file containing the requested positions.

[pool-1-thread-1] ERROR net.maizegenetics.plugindef.AbstractPlugin - Allele in genotype ACCACTGCCGGATCTGGAGGCCGGGCCACCGCCGCCGCCCCTG not in the variant context [A*, G] [pool-1-thread-1] INFO net.maizegenetics.plugindef.AbstractPlugin - Finished net.maizegenetics.pangenome.pipeline.ImputePipelinePlugin: time: Feb 19, 2023 5:27:34 [pool-1-thread-1] INFO net.maizegenetics.pipeline.TasselPipeline - net.maizegenetics.pangenome.pipeline.ImputePipelinePlugin: time: Feb 19, 2023 5:27:34: progress: 100%

ADD COMMENT

Login before adding your answer.

Traffic: 2650 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6