How can I use bcftools mpileup or an alternative to find ALL variants without any probabilistic inference?
1
0
Entering edit mode
15 months ago
chaco001 ▴ 40

Hello!

I have a pipeline for a maximum depth sequencing project. Briefly, this means I can ignore PCR errors because I check for consensus of UMI-tagged sequences. Therefore, once I have a consensus bam, I'd like to be able to call all variants within it, without trying to correct for the probability of errors.

I am having trouble doing this with bcftools mpileup. It finds SNPs quite well, but does not seem to find deletions. I know that the consensus has some deletions, because I can see mapped sequences with deletions in the CIGAR string, like the following example:

testsample:32848    99  mygenome    12814   60  4M1D131M    =   12814   152 CAATCGGAGCTTTACCTCTTCTTCACTACAAAGCATGGGGTTTCAAAACGAACATCGCTATCTCAATTCGCTAATATCCGCAACAATGGTCTAATTGCTCTGAGTCTTCGTGAAGATGATGAACTGATGGGTGTA NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NM:i:1  MD:Z:4^G131 MC:Z:4M1D147M   AS:i:131    XS:i:0

I am pretty sure I'm using the correct bctools mpileup arguments to call indels with high depth and no probabilistic base calling, but I may be doing something wrong. I would have expected to see the deletion shown above in my output vcf but I do not. Here is my bcftools mpileup call:

    bcftools mpileup \
        -f path/to/my/genome \
        -d 1000000 \
        -a AD,DP \
        -o pileup.vcf \
        --no-BAQ \
        -L 1000000 \
        consensus.bam

Thank you for your help!

Fgbio UMI variant-calling • 1.2k views
ADD COMMENT
1
Entering edit mode
15 months ago
cfos4698 ★ 1.1k

To generate a VCF file one would normally pipe the input of an mpileup command into an actual call command. For example:

bcftools mpileup \
    -f path/to/my/genome \
    -d 1000000 \
    -a AD,DP \
    --no-BAQ \
    -L 1000000 \
    consensus.bam | \
bcftools call --keep-alts --multiallelic-caller --variants-only -Ov -o file.vcf

Obviously you should tailor the parameters for bcftools call to your needs.

ADD COMMENT
0
Entering edit mode

Thanks for your reply. The problem is the output from mpileup doesn't contain the deletions, so neither will call.

ADD REPLY

Login before adding your answer.

Traffic: 1591 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6