UMI and index sequence in RNA-seq data
0
0
Entering edit mode
7 weeks ago
aminijavad4 ▴ 10

Hi, I have small RNA-seq data that contain UMI and index sequences; however, I don't have their sequences and I don't know their location, what should I do to d-duplication reads and remove UMI and index sequences? I'll appreciate any help!

@NS500318:1217:HY5LKBGXT:1:11101:14039:1050 1:N:0:CTCTGATGGC+NTTATGAGGC GACTCNTAGCGGTGGATCACTCGGCAACTGTAGGCACCNTCAATTTTATTAAGGCTAGATCGGAAGAGCACA + AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

@NS500318:1217:HY5LKBGXT:1:11101:8110:1051 1:N:0:CTCTGATGGC+NTTATGAGGC GACTCNTAGCGGTGGATCACTCGGCAACTGTAGGCACCATCAATAAAACACTAGGCAGATCGGAAGAGCACA + AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

@NS500318:1217:HY5LKBGXT:1:11101:24435:1052 1:N:0:CTCTGATGGC+NTTATGAGGC GACTCNTAGCGGTGGATCACTCGGCAACTGTAGGCACCATCAATCTCAGACCACCAAGATCGGAAGAGCACA + AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEE

@NS500318:1217:HY5LKBGXT:1:11101:20765:1054 1:N:0:CTCTGATGGC+NTTATGAGGC AGAGGNCGTGAAACCGTTAAGAGGTAACTGTAGGCACCATCAATCCATGTAACCCGAGATCGGAAGAGCAAC + AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

@NS500318:1217:HY5LKBGXT:1:11101:20220:1058 1:N:0:CTCTGATGGC+NTTATGAGGC GTTTCNGTAGTGTAGTGGTTATCACGTTCGCCTAACTGTAGGCACCATCAATACGGGAGCCACCAGATCGGA + AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

RNA-seq • 259 views
ADD COMMENT
0
Entering edit mode

You will probably have better luck troubleshooting this issue by getting in contact with the person or company who prepared your libraries.

ADD REPLY

Login before adding your answer.

Traffic: 1503 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6