User: Charles Plessy

gravatar for Charles Plessy
Charles Plessy2.1k
Reputation:
2,060
Status:
Trusted
Location:
Japan
Website:
http://population-tran...
Last seen:
10 minutes ago
Joined:
2 years, 11 months ago
Email:
c***************@plessy.org

Posts by Charles Plessy

<prev • 220 results • page 1 of 22 • next >
1
vote
2
answers
190
views
2
answers
Answer: A: Remove the last few bases from fasta sequences
... If you do not mind that the number of bases per lines gets changed, you can use the `seqret` command from the [EMBOSS](http://emboss.sourceforge.net/apps/release/6.6/emboss/apps/seqret.html) package. $ cat gene1.fa >gene1 CACTGATTTGAGTTTTTTTCATAAATCAGAAACCGTTTGAATTATAAAAA AAAAAA ...
written 6 days ago by Charles Plessy2.1k
2
votes
5
answers
808
views
5
answers
Answer: A: Declining quality of biostars
... There may be a timezone effect as well: in the morning, Japan time, I see a lot of unanswered questions, which is not surprising since much of the Biostar community is asleep. Conversely, if I ask a question at work hours, Japan time, I have the impression that first nothing happens and then it tend ...
written 16 days ago by Charles Plessy2.1k
1
vote
2
answers
157
views
2
answers
Answer: A: Running Primer3 to give Tm values only
... Primer 3 provides additional command-line tools, among which `oligotm`, that you may find useful. [(see this link to its manual page in Debian)](https://manpages.debian.org/stretch/primer3/oligotm.1.en.html) ...
written 18 days ago by Charles Plessy2.1k
0
votes
1
answer
110
views
1
answers
Answer: A: Define exact peak borders
... There are many alternative peak callers, but among them perhaps you can have a look at [paraclu](http://cbrc3.cbrc.jp/~martin/paraclu/). ![](http://cbrc3.cbrc.jp/~martin/paraclu/paraclu_sketch.png) Since it outputs nested clusters, you can define by yourself a threshold that corresponds to granula ...
written 23 days ago by Charles Plessy2.1k
3
votes
1
answer
141
views
1
answers
Answer: A: mouse Cx30 promoter
... Like many other genes, *Gjb6* (*Cx30*) has multiple promoters. The [FANTOM5 project](http://fantom.gsc.riken.jp/5/) provides gene-centric pages to browse a gene's alternative promoters. Here is the link for *Gjb6*: . ...
written 24 days ago by Charles Plessy2.1k
0
votes
5
answers
246
views
5
answers
Comment: C: Run Samtools on multiple files
... Indeed, a `for` loop better answers to your question. Nevertheless, if you run `parallel` and limit the number of concurrent jobs to 1 (`--jobs 1`) you will also be able to run the commands sequentially, basically like in a `for` loop. And you will have learned a new tool :) ...
written 26 days ago by Charles Plessy2.1k
2
votes
5
answers
246
views
5
answers
Answer: A: Run Samtools on multiple files
... The `*` wildcard character can only expand to already existing files (`*.bam` in your example). The command-line interpreter can not guess your intent and provide contents for `*.sorted.bam`. Moreover, `samtools sort` is not designed to run on multiple files in parallel. However, there are generic ...
written 26 days ago by Charles Plessy2.1k
0
votes
2
answers
290
views
2
answers
Comment: C: "TRUE" instead of "T" allele in R
... You are welcome. Please click on the "Accept!" button so that my answer appears at the top of the list. This is important since the other answer does not solve the problem. ...
written 4 weeks ago by Charles Plessy2.1k
1
vote
2
answers
290
views
2
answers
Comment: C: "TRUE" instead of "T" allele in R
... Not that I know, > system("printf 'A C T G\nA C T G\n' > test.txt") > read.table("test.txt") V1 V2 V3 V4 1 A C TRUE G 2 A C TRUE G > data.table::fread("test.txt", head = F) V1 V2 V3 V4 1: A C TRUE G 2: A C TRUE G > as.data.frame(readr::read_delim("test.txt", " ...
written 4 weeks ago by Charles Plessy2.1k
6
votes
2
answers
290
views
2
answers
Answer: A: "TRUE" instead of "T" allele in R
... `read.table()` tries to guess the class of the input data and will sometimes be mislead. > read.table(text=("A C G T")) V1 V2 V3 V4 1 A C G TRUE > summary(read.table(text=("A C G T"))) V1 V2 V3 V4 A:1 C:1 G:1 Mode:logical ...
written 4 weeks ago by Charles Plessy2.1k

Latest awards to Charles Plessy

Popular Question 14 days ago, created a question with more than 1,000 views. For Patch ERCC spike sequences to get their real 5-prime ends.
Scholar 24 days ago, created an answer that has been accepted. For A: Bedtools trouble with double digit chromosomes
Teacher 24 days ago, created an answer with at least 3 up-votes. For A: fastq compression tools of choice
Teacher 28 days ago, created an answer with at least 3 up-votes. For A: fastq compression tools of choice
Good Answer 29 days ago, created an answer that was upvoted at least 5 times. For A: Develop an R package for CRAN vs BioConductor
Appreciated 29 days ago, created a post with more than 5 votes. For Patch ERCC spike sequences to get their real 5-prime ends.
Scholar 4 weeks ago, created an answer that has been accepted. For A: Bedtools trouble with double digit chromosomes
Teacher 4 weeks ago, created an answer with at least 3 up-votes. For A: fastq compression tools of choice
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: fastq compression tools of choice
Commentator 9 weeks ago, created a comment with at least 3 up-votes. For C: why does this pipe work
Good Answer 12 weeks ago, created an answer that was upvoted at least 5 times. For A: Develop an R package for CRAN vs BioConductor
Scholar 12 weeks ago, created an answer that has been accepted. For A: Bedtools trouble with double digit chromosomes
Scholar 12 weeks ago, created an answer that has been accepted. For A: Bedtools trouble with double digit chromosomes
Teacher 12 weeks ago, created an answer with at least 3 up-votes. For A: fastq compression tools of choice
Appreciated 12 weeks ago, created a post with more than 5 votes. For Patch ERCC spike sequences to get their real 5-prime ends.
Teacher 12 weeks ago, created an answer with at least 3 up-votes. For A: fastq compression tools of choice
Appreciated 3 months ago, created a post with more than 5 votes. For Patch ERCC spike sequences to get their real 5-prime ends.
Scholar 3 months ago, created an answer that has been accepted. For A: Bedtools trouble with double digit chromosomes
Appreciated 4 months ago, created a post with more than 5 votes. For Patch ERCC spike sequences to get their real 5-prime ends.
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: fastq compression tools of choice
Popular Question 4 months ago, created a question with more than 1,000 views. For Patch ERCC spike sequences to get their real 5-prime ends.
Appreciated 5 months ago, created a post with more than 5 votes. For Patch ERCC spike sequences to get their real 5-prime ends.
Good Answer 5 months ago, created an answer that was upvoted at least 5 times. For A: Develop an R package for CRAN vs BioConductor
Appreciated 5 months ago, created a post with more than 5 votes. For Patch ERCC spike sequences to get their real 5-prime ends.
Scholar 5 months ago, created an answer that has been accepted. For A: Bedtools trouble with double digit chromosomes

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 807 users visited in the last hour