User: mark.rose

gravatar for mark.rose
mark.rose40
Reputation:
40
Status:
New User
Location:
United States
Last seen:
3 days, 8 hours ago
Joined:
6 years, 1 month ago
Email:
m********@syngenta.com

Posts by mark.rose

<prev • 77 results • page 1 of 8 • next >
0
votes
0
answers
64
views
0
answers
Comment: C: VCFs appear inconsistent with view of alignment
... Actually I tried doing both but they never appeared correctly in the preview window so I must be doing something wrong ...
written 6 days ago by mark.rose40
0
votes
0
answers
64
views
0
answers
VCFs appear inconsistent with view of alignment
... Hi All I've aligned pacbio ccs reads to a small reference sequence using minimap2 and viewed the result in IGV. The alignments look good, with generally very few discrepancies with the reference. There is one region, however where more variations are observed and that is at a string of 13 Cs. Th ...
vcf gatk freebayes bbmap igv written 6 days ago by mark.rose40
0
votes
0
answers
104
views
0
answers
Comment: C: genome in IGV session file
... Because I want to make links to the session files, so that one click loads everything for a sample. There will be very many different reference "genomes" used. ...
written 8 weeks ago by mark.rose40
0
votes
0
answers
104
views
0
answers
genome in IGV session file
... Hi All Is it possible to load a genome in an IGV session file. The only examples I've seen are specifying one of the preloaded genomes (e.g hg18) but I would like to load a custom genome via the session file which loads the data tracks as well. Thanks for you help Mark ...
genome xml igv session written 9 weeks ago by mark.rose40
0
votes
0
answers
193
views
0
answers
Comment: C: anomalous alignment with bowtie2
... The blast alignments are against to different blast dbs. For reference 1 I am selecting the top hit (so that bowtie2 produces an XS tag for the reference 1 alignment seems correct). There is only 1 sequence in the blast db for reference 2. ...
written 8 months ago by mark.rose40
0
votes
0
answers
193
views
0
answers
anomalous alignment with bowtie2
... Hi All I getting what appears to be an anomalous alignment with bowtie2 (v2.3.4). Consider the following: reference1 M00831:461:000000000-CP4BP:1:2105:10688:18697 99 AGRO_LBA4404_1|NODE_23 996 31 100M = 1213 267 CTCGACTGGCAATGAGAAGTTGCTCGCGCGATAGAACGTCGCGGGGTTTCTCTAAAAACGCGAGGAGAAGATTGA ...
bowtie2 alignment bowtie blast score written 8 months ago by mark.rose40 • updated 8 months ago by genomax90k
0
votes
0
answers
691
views
0
answers
BBMAP fails to find secondary alignment
... I am using BBMAP to align to a reference genome. I am allowing secondary hits because it is my intention to evaluate the mapping quality of those hits to identify and discard query sequences that produce multiple hits with MAPQs above a certain threshold compared to the top hit (i.e. I only want to ...
bbmap secondary written 23 months ago by mark.rose40 • updated 22 months ago by Biostar ♦♦ 20
0
votes
1
answer
665
views
1
answers
Comment: C: BBMAP paired end alignment problem
... Hey, thanks for the tip ...
written 23 months ago by mark.rose40
0
votes
1
answer
665
views
1
answers
Comment: C: BBMAP paired end alignment problem
... Yes, it occurred to me ( in the middle of the night ;-) ) that I should check the bitflags. Thanks for taking a closer look too. I will keep this in mind. ...
written 23 months ago by mark.rose40
0
votes
1
answer
665
views
1
answers
Comment: C: BBMAP paired end alignment problem
... $ samtools view SMX008C05-00067_S67_L001.aligned.sam | head -5 K00333:82:HTWHKBBXX:1:1101:27844:3565 1:N:0:TGCAACCGGTCC 99 MAIZE_B73_REF_5_GENOME|10 41935338 10 3=1X3=3X3=2X2=3X1=6X1=1X1=1X2=2I1X3=2X2=2X7=1X1=1X1=53D2=2X4=1X85= = 41935473 285 ...
written 23 months ago by mark.rose40

Latest awards to mark.rose

Popular Question 8 months ago, created a question with more than 1,000 views. For calling phased variants
Popular Question 8 months ago, created a question with more than 1,000 views. For calling phased variants
Popular Question 18 months ago, created a question with more than 1,000 views. For calling phased variants
Popular Question 18 months ago, created a question with more than 1,000 views. For freebayes haplotype calling (phased variants)
Popular Question 18 months ago, created a question with more than 1,000 views. For Picard ExtractIlluminaBarcodes error
Popular Question 18 months ago, created a question with more than 1,000 views. For Varscan variant calll error on pacbio data
Popular Question 22 months ago, created a question with more than 1,000 views. For Varscan variant calll error on pacbio data
Popular Question 22 months ago, created a question with more than 1,000 views. For bam- readcount error
Popular Question 22 months ago, created a question with more than 1,000 views. For calling phased variants
Popular Question 22 months ago, created a question with more than 1,000 views. For freebayes haplotype calling (phased variants)
Popular Question 2.3 years ago, created a question with more than 1,000 views. For calling phased variants
Scholar 2.3 years ago, created an answer that has been accepted. For A: Picard ExtractIlluminaBarcodes error
Popular Question 3.2 years ago, created a question with more than 1,000 views. For freebayes haplotype calling (phased variants)
Popular Question 3.2 years ago, created a question with more than 1,000 views. For discordant alignments when bowtie2 set to --no-discordant
Popular Question 5.6 years ago, created a question with more than 1,000 views. For unexpected bowtie2 unpaired alignment behavior

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1635 users visited in the last hour