User: mark.rose

gravatar for mark.rose
mark.rose40
Reputation:
40
Status:
New User
Location:
United States
Last seen:
2 months, 2 weeks ago
Joined:
6 years, 5 months ago
Email:
m********@syngenta.com

Posts by mark.rose

<prev • 80 results • page 1 of 8 • next >
0
votes
0
answers
147
views
0
answers
PacBio's variantCaller's vcf inconsistent with it's consensus sequence
... I'm having a problem with variant calling on some PacBio RS II data. Ive aligned my reads against different small reference (~15kb) using blasr and then ran the resulting bam file through PacBio's samtlink version 6 variantCaller as follows: variantCaller --algorithm arrow --log-file variantC ...
vcf consensus variantcaller variant pacbio written 11 weeks ago by mark.rose40 • updated 7 weeks ago by Biostar ♦♦ 20
0
votes
0
answers
132
views
0
answers
gatk haplotypecaller report a mush lower coverage than seen in alignment
... Hi All I trying to use gatk's haplotype caller to call variants on pbmm2 aligned PacBio CCS reads thusly: gatk HaplotypeCaller --reference ../30L02and17L22.2snps.fa --input m200715_080201_42269_c101526542550000001823318810042135_s1_p0.ccs.bam-vs-25C11and66H02.2snps.sort.bam --output m200715_08 ...
haplotypecaller gatk alignment dp coverage written 3 months ago by mark.rose40
0
votes
0
answers
138
views
0
answers
(Closed) gatk haplotypecaller report a mush lower coverage than seen in alignment
... Hi All I trying to use gatk's haplotype caller to call variants on pbmm2 aligned PacBio CCS reads thusly: gatk HaplotypeCaller --reference ../30L02and17L22.2snps.fa --input m200715_080201_42269_c101526542550000001823318810042135_s1_p0.ccs.bam-vs-25C11and66H02.2snps.sort.bam --output m200715_08 ...
haplotypecaller gatk alignment dp coverage written 3 months ago by mark.rose40
0
votes
0
answers
178
views
0
answers
Comment: C: VCFs appear inconsistent with view of alignment
... Actually I tried doing both but they never appeared correctly in the preview window so I must be doing something wrong ...
written 3 months ago by mark.rose40
0
votes
0
answers
178
views
0
answers
VCFs appear inconsistent with view of alignment
... Hi All I've aligned pacbio ccs reads to a small reference sequence using minimap2 and viewed the result in IGV. The alignments look good, with generally very few discrepancies with the reference. There is one region, however where more variations are observed and that is at a string of 13 Cs. Th ...
vcf gatk freebayes bbmap igv written 3 months ago by mark.rose40
0
votes
0
answers
176
views
0
answers
Comment: C: genome in IGV session file
... Because I want to make links to the session files, so that one click loads everything for a sample. There will be very many different reference "genomes" used. ...
written 5 months ago by mark.rose40
0
votes
0
answers
176
views
0
answers
genome in IGV session file
... Hi All Is it possible to load a genome in an IGV session file. The only examples I've seen are specifying one of the preloaded genomes (e.g hg18) but I would like to load a custom genome via the session file which loads the data tracks as well. Thanks for you help Mark ...
genome xml igv session written 5 months ago by mark.rose40
0
votes
0
answers
242
views
0
answers
Comment: C: anomalous alignment with bowtie2
... The blast alignments are against to different blast dbs. For reference 1 I am selecting the top hit (so that bowtie2 produces an XS tag for the reference 1 alignment seems correct). There is only 1 sequence in the blast db for reference 2. ...
written 11 months ago by mark.rose40
0
votes
0
answers
242
views
0
answers
anomalous alignment with bowtie2
... Hi All I getting what appears to be an anomalous alignment with bowtie2 (v2.3.4). Consider the following: reference1 M00831:461:000000000-CP4BP:1:2105:10688:18697 99 AGRO_LBA4404_1|NODE_23 996 31 100M = 1213 267 CTCGACTGGCAATGAGAAGTTGCTCGCGCGATAGAACGTCGCGGGGTTTCTCTAAAAACGCGAGGAGAAGATTGA ...
bowtie2 alignment bowtie blast score written 11 months ago by mark.rose40 • updated 11 months ago by GenoMax94k
0
votes
0
answers
798
views
0
answers
BBMAP fails to find secondary alignment
... I am using BBMAP to align to a reference genome. I am allowing secondary hits because it is my intention to evaluate the mapping quality of those hits to identify and discard query sequences that produce multiple hits with MAPQs above a certain threshold compared to the top hit (i.e. I only want to ...
bbmap secondary written 2.2 years ago by mark.rose40 • updated 2.2 years ago by Biostar ♦♦ 20

Latest awards to mark.rose

Popular Question 11 months ago, created a question with more than 1,000 views. For calling phased variants
Popular Question 11 months ago, created a question with more than 1,000 views. For calling phased variants
Popular Question 22 months ago, created a question with more than 1,000 views. For calling phased variants
Popular Question 22 months ago, created a question with more than 1,000 views. For freebayes haplotype calling (phased variants)
Popular Question 22 months ago, created a question with more than 1,000 views. For Picard ExtractIlluminaBarcodes error
Popular Question 22 months ago, created a question with more than 1,000 views. For Varscan variant calll error on pacbio data
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Varscan variant calll error on pacbio data
Popular Question 2.2 years ago, created a question with more than 1,000 views. For bam- readcount error
Popular Question 2.2 years ago, created a question with more than 1,000 views. For calling phased variants
Popular Question 2.2 years ago, created a question with more than 1,000 views. For freebayes haplotype calling (phased variants)
Popular Question 2.6 years ago, created a question with more than 1,000 views. For calling phased variants
Scholar 2.6 years ago, created an answer that has been accepted. For A: Picard ExtractIlluminaBarcodes error
Popular Question 3.5 years ago, created a question with more than 1,000 views. For freebayes haplotype calling (phased variants)
Popular Question 3.5 years ago, created a question with more than 1,000 views. For discordant alignments when bowtie2 set to --no-discordant
Popular Question 5.9 years ago, created a question with more than 1,000 views. For unexpected bowtie2 unpaired alignment behavior

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1437 users visited in the last hour
_