User: rmf

gravatar for rmf
rmf340
Reputation:
340
Status:
Trusted
Location:
Last seen:
3 days, 3 hours ago
Joined:
3 years, 7 months ago
Email:
r**********@gmail.com

Posts by rmf

<prev • 112 results • page 1 of 12 • next >
2
votes
1
answer
209
views
1
answers
Comment: C: Raw counts to TPM in R
... Cool! I get the same result. # michael's version # https://support.bioconductor.org/p/91218/ tpm3 <- function(counts,len) { x <- counts/len return(t(t(x)*1e6/colSums(x))) } Michael's version is much faster despite all the transposes. ![enter image description h ...
written 25 days ago by rmf340 • updated 24 days ago by RamRS17k
6
votes
1
answer
209
views
1
answer
Raw counts to TPM in R
... Can someone verify if this R code for converting raw counts to TPM is correct? #' @title Compute TPM for a read count matrix #' @param dfr A numeric data.frame of read counts with samples (columns) and genes (rows). #' @param len A vector of gene cds length equal to number of rows of df ...
R rna-seq written 25 days ago by rmf340
1
vote
4
answers
311
views
4
answers
Comment: C: Similarity between two FASTA files
... Probably because there are very little gaps in alignments. Also I suppose the mash distance could be improved by setting a better value for the kmer length. I used 12 arbitrarily. ...
written 7 weeks ago by rmf340
0
votes
4
answers
311
views
4
answers
Comment: C: Similarity between two FASTA files
... Oh. I wasn't aware of that. Good to know. Thx! ...
written 7 weeks ago by rmf340
0
votes
4
answers
311
views
4
answers
Comment: C: Similarity between two FASTA files
... @genomax I used emboss `needle` as the final solution which is why I accepted that as the answer. ...
written 7 weeks ago by rmf340
3
votes
4
answers
311
views
4
answers
Answer: A: Similarity between two FASTA files
... Comparing pairwise similarity measures between ~3000 fasta pairs in the size range 0-10000 nt. **blast_identity**: Percentage identity as returned by BLASTN blastn -query query.fa -subject ref.fa -task blastn -outfmt "6 pident nident" **nw_identity**: Percentage identity as returned by need ...
written 7 weeks ago by rmf340
0
votes
4
answers
311
views
4
answers
Comment: C: Similarity between two FASTA files
... They are comparable in lengths. The length difference range from 0 to 83 nt. ...
written 7 weeks ago by rmf340
0
votes
4
answers
311
views
4
answers
Comment: C: Similarity between two FASTA files
... I am comparing human X and Y chromosomes. Y is rearranged and jumbled up. But I have already identified short regions in X that correspond with Y. Now I just need to figure out how similar they are. Here is an example >chrX:153598967-153599086 TCCATGATGAACCTCGCCACTCGGAAGTGCACCCTGGCTTCGGG ...
written 7 weeks ago by rmf340
0
votes
4
answers
311
views
4
answers
Comment: C: Similarity between two FASTA files
... Ah yes! Good point. But, does local matter for short sequences of few hundred nucleotides? ...
written 7 weeks ago by rmf340
0
votes
4
answers
311
views
4
answers
Comment: A: Similarity between two FASTA files
... I haven't tried all the suggestions here, but I came across this BLAST usage: blastn -query "query.fa" -subject "ref.fa" -task "blastn" -outfmt 6 >> blast_results.txt And this returns query ref per_ident aln_len mismatch gapopen qstart qend sstart send evalue bitscore ...
written 7 weeks ago by rmf340

Latest awards to rmf

Popular Question 12 days ago, created a question with more than 1,000 views. For Design matrix not of full rank.
Scholar 7 weeks ago, created an answer that has been accepted. For A: bowtie2-build cannot use multiple cores
Teacher 7 weeks ago, created an answer with at least 3 up-votes. For A: LD-decay in a r2 vs distance(cm) plot
Popular Question 11 weeks ago, created a question with more than 1,000 views. For RNA-Seq experiment has low fold change
Popular Question 4 months ago, created a question with more than 1,000 views. For RNA-Seq experiment has low fold change
Popular Question 4 months ago, created a question with more than 1,000 views. For Design matrix not of full rank.
Centurion 5 months ago, created 100 posts.
Scholar 5 months ago, created an answer that has been accepted. For A: bowtie2-build cannot use multiple cores
Appreciated 6 months ago, created a post with more than 5 votes. For A: LD-decay in a r2 vs distance(cm) plot
Good Answer 6 months ago, created an answer that was upvoted at least 5 times. For A: LD-decay in a r2 vs distance(cm) plot
Popular Question 7 months ago, created a question with more than 1,000 views. For Design matrix not of full rank.
Scholar 7 months ago, created an answer that has been accepted. For A: bowtie2-build cannot use multiple cores
Scholar 7 months ago, created an answer that has been accepted. For A: Regenotype vcf using some samples as reference
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: LD-decay in a r2 vs distance(cm) plot
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: LD-decay in a r2 vs distance(cm) plot
Scholar 8 months ago, created an answer that has been accepted. For A: bowtie2-build cannot use multiple cores
Voter 9 months ago, voted more than 100 times.
Popular Question 12 months ago, created a question with more than 1,000 views. For Design matrix not of full rank.
Popular Question 13 months ago, created a question with more than 1,000 views. For Design matrix not of full rank.
Popular Question 22 months ago, created a question with more than 1,000 views. For RNA Seq: GC Content extra peak
Student 22 months ago, asked a question with at least 3 up-votes. For Consequences of degraded DNA for Sequencing
Scholar 23 months ago, created an answer that has been accepted. For A: bowtie2-build cannot use multiple cores
Supporter 2.3 years ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 721 users visited in the last hour