User: sacha

gravatar for sacha
sacha1.0k
Reputation:
1,020
Status:
Trusted
Location:
France
Website:
http://dridk.me/
Twitter:
dridk
Last seen:
1 day, 21 hours ago
Joined:
2 years, 10 months ago
Email:
s****@labsquare.org

doctor in molecular genetics
Rennes Hospital - genomics laboratory

Posts by sacha

<prev • 211 results • page 1 of 22 • next >
1
vote
2
answers
881
views
2
answers
Answer: A: Where to get somatic mutations from WGS data?!
... If you need cancer genomics data, take a look on ICGC : https://dcc.icgc.org/ and the PCAWG project https://dcc.icgc.org/pcawg ...
written 2 days ago by sacha1.0k
0
votes
1
answer
94
views
1
answers
Answer: A: What is microbiome community structure?
... Metagenomics analysis or 16S analysis ends up in most case on the OTU table. OTU table is a double entry table where row are bugs and columns are samples. For instance, after sequencing 4 differents samples, you end up with the following OTU table . | | sample1 | sample2 | samp ...
written 4 days ago by sacha1.0k
1
vote
7
answers
745
views
7
answers
Answer: A: shannon entropy score
... '[seqtk][1] comp' command return #A,#C,#G,#T composition. With the following fasta file : >seq1 AAAA >seq2 ATCGACTTTTTTGTAGTACGTA You can run this oneliner to get Shannon entropy score for each sequence in your fasta. seqtk comp test.fa|awk '{for(i=3;i<=6;i++){i ...
written 4 days ago by sacha1.0k
0
votes
7
answers
8.9k
views
7
answers
Answer: A: How to count fastq reads
... 'wc' is faster than awk #yourfile.fastq echo $(cat yourfile.fastq|wc -l)/4|bc #yourfile.fastq.gz echo $(zcat yourfile.fastq.gz|wc -l)/4|bc ...
written 4 days ago by sacha1.0k
1
vote
0
answers
417
views
0
answers
Comment: C: CutePeaks : A Sanger Trace file viewer
... 0.2.0 has been released with following binary for different os : - [Windows binary][1] - [MacOS][2] - [Linux ][3] [1]: https://github.com/labsquare/CutePeaks/releases/download/0.2.0/cutepeaks-0.2.0-win32.zip [2]: https://github.com/labsquare/CutePeaks/releases/download/0.2.0/cu ...
written 26 days ago by sacha1.0k
1
vote
2
answers
184
views
2
answers
Answer: A: Get trace data for all four bases from ab1 file
... You can also test cutepeaks, a free gui software : https://github.com/labsquare/CutePeaks. # Download the latest binary for linux wget https://github.com/labsquare/CutePeaks/releases/download/0.2.0/cutepeaks-0.2.0-linux-x86_64.appimage # make it executable chmod +x cutepeaks ...
written 27 days ago by sacha1.0k
1
vote
3
answers
252
views
3
answers
Answer: A: String matching algorithms of biological sequences
... Have a look on seqan c++ library. http://seqan.readthedocs.io/en/master/ For instance, it uses 2 bits per nucleotides instead 8 used by plain text sequence. ...
written 28 days ago by sacha1.0k
1
vote
4
answers
152
views
4
answers
Answer: A: How to find the gene structure of a gene?
... RefGene: http://hgdownload.cse.ucsc.edu/goldenpath/hg19/database/refGene.txt.gz ...
written 4 weeks ago by sacha1.0k
0
votes
2
answers
325
views
2
answers
Comment: C: Exon coordinates and sequence
... There are many transcripts for one gene. You can replace the gene name by the transcript name to have a unique identifier : print(chrom, start, end, name2,sens, name) by print(chrom, start, end, name,sens, name) ...
written 4 weeks ago by sacha1.0k
1
vote
2
answers
325
views
2
answers
Comment: C: Exon coordinates and sequence
... One sequence = exon1+exon2+...+exonN ...
written 4 weeks ago by sacha1.0k

Latest awards to sacha

Teacher 20 days ago, created an answer with at least 3 up-votes. For A: awk filed with different separator
Guru 4 weeks ago, received more than 100 upvotes.
Scholar 5 weeks ago, created an answer that has been accepted. For A: bcftools extract data
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: awk filed with different separator
Popular Question 6 weeks ago, created a question with more than 1,000 views. For Big Browser : a new genom browser in development
Popular Question 6 weeks ago, created a question with more than 1,000 views. For Stop to make GUI with Java .... Use Qt 5 !!
Scholar 6 weeks ago, created an answer that has been accepted. For A: bcftools extract data
Popular Question 7 months ago, created a question with more than 1,000 views. For Big Browser : a new genom browser in development
Scholar 9 months ago, created an answer that has been accepted. For A: bcftools extract data
Scholar 10 months ago, created an answer that has been accepted. For A: bcftools extract data
Popular Question 10 months ago, created a question with more than 1,000 views. For Big Browser : a new genom browser in development
Epic Question 11 months ago, created a question with more than 10,000 views. For Stop to make GUI with Java .... Use Qt 5 !!
Appreciated 13 months ago, created a post with more than 5 votes. For Big Browser : a new genom browser in development
Appreciated 14 months ago, created a post with more than 5 votes. For A: Plotting SNP density along a chromosome from VCF files
Appreciated 15 months ago, created a post with more than 5 votes. For A: Plotting SNP density along a chromosome from VCF files
Good Answer 15 months ago, created an answer that was upvoted at least 5 times. For A: Plotting SNP density along a chromosome from VCF files
Scholar 15 months ago, created an answer that has been accepted. For A: bcftools extract data
Teacher 15 months ago, created an answer with at least 3 up-votes. For A: Plotting SNP density along a chromosome from VCF files
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: awk filed with different separator
Scholar 16 months ago, created an answer that has been accepted. For A: bcftools extract data
Great Question 17 months ago, created a question with more than 5,000 views. For Stop to make GUI with Java .... Use Qt 5 !!
Centurion 18 months ago, created 100 posts.
Scholar 18 months ago, created an answer that has been accepted. For A: bcftools extract data
Scholar 18 months ago, created an answer that has been accepted. For A: bcftools extract data
Supporter 19 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 501 users visited in the last hour