User: mhasa006

gravatar for mhasa006
mhasa00650
Reputation:
50
Status:
Trusted
Location:
United States
Last seen:
2 months, 1 week ago
Joined:
5 years, 9 months ago
Email:
m*******@ucr.edu

Posts by mhasa006

<prev • 27 results • page 1 of 3 • next >
2
votes
1
answer
233
views
1
answer
Soft Clipped read 3' end position
... Note: clarifying my question. How can I get the hard clipped 3' end of the read position where there is soft clip at either end of the read? The `getUnclippedEnd()` in `htsjdk` gives you the position of the 3' end of the read including the soft-clipped bases. Is there a function like this to get th ...
htsjdk java bam written 10 weeks ago by mhasa00650 • updated 10 weeks ago by d-cameron2.3k
1
vote
1
answer
224
views
1
answer
Reading not properly paired reads from a BAM file
... I have following BAM file NB551232:115:H2VJHBGXF:2:22303:20719:3554:CT:GT 97 chr3 17443 54 70M = 17458 72 GTCATATAGATGATGACTGATTTACCCTTTTACTCTGCATGCAGCTTCTCCTGATGGAGTATCGTTTGTG EEE6/EEAEEAAEEAAEA/E/AEE/ ...
java bam samreader written 5 months ago by mhasa00650 • updated 5 months ago by Pierre Lindenbaum134k
2
votes
1
answer
1.1k
views
1
answer
Cancer data download with normal sample
... I want to download cancer dataset that contains some normal (control) samples too. Right now I can download data from [BoradInstitute][1] but I believe the dataset only contains cancerous patients information. For example, I need to download Breast cancer methylation dataset where I can have methyla ...
normal tcga cancer data cancer written 2.1 years ago by mhasa00650 • updated 2.1 years ago by Kevin Blighe71k
0
votes
0
answers
635
views
0
answers
Comment: C: BLAST against cancer genome
... I don't have the genomes. I am looking for cancer genomes. ...
written 2.3 years ago by mhasa00650
0
votes
0
answers
635
views
0
answers
Comment: C: BLAST against cancer genome
... I need to find if the gene is translocated. ...
written 2.3 years ago by mhasa00650
0
votes
0
answers
635
views
0
answers
BLAST against cancer genome
... I need to BLAST a particular gene against many cancer genomes. Is there a tool/webtool where I can do that? If not, where can I find the latest downloads of cancer genomes? I can run BLAST locally then. But I would prefer if there is a webtool for this. Thanks. ...
gene genome blast cancer written 2.3 years ago by mhasa00650 • updated 2.3 years ago by Biostar ♦♦ 20
1
vote
1
answer
566
views
1
answer
Efficient processing of a read and its mate from bam file
... I have BAM file sorted based on the position. But to process each read, I also need to access its mate information. I'm using `htsjdk` package and right now, I'm accessing the mate information with `queryMate()`. However, `queryMate()` is extremely expensive and for large BAM file it is taking a lot ...
htsjdk java bam samtools sam written 2.6 years ago by mhasa00650 • updated 2.6 years ago by finswimmer14k
2
votes
1
answer
803
views
1
answer
Extract the mate pair information with htsjdk
... I have a BAM file sorted by position. I need to process a group of reads from the BAM file at a time. To process that, I need to access the mate pair of each of these read at the same time. Is there a way using `htsjdk` to access the mate pair information using the information of the other pair. I ...
htsjdk bam samtools written 2.6 years ago by mhasa00650 • updated 2.6 years ago by Pierre Lindenbaum134k
2
votes
1
answer
980
views
1
answer
Extract the SAM File header section
... How can I extract the header section of the SAM File with `htsjdk` package? Below is an example of a SAM File @HD VN:1.3 SO:coordinate @SQ SN:chr1 LN:248956422 @SQ SN:chr10 LN:133797422 @SQ SN:chr11 LN:135086622 XXX:111:312:1312 99 chr1 ...
htsjdk java bam samtools sam written 2.6 years ago by mhasa00650 • updated 2.6 years ago by Pierre Lindenbaum134k
0
votes
0
answers
555
views
0
answers
Forum: Cancer related problem with sequencing data and deep neural network
... I am fairly new to both Cancer research and Deep Neural Networks (DNN). I want to do some research mostly classification problem using the sequence data in the area of cancer research. Could anyone guide me towards the materials/publications I can read regarding this? I have tried to do cancer type ...
forum sequence rna-seq deep neural network cancer written 2.9 years ago by mhasa00650

Latest awards to mhasa006

Popular Question 4 months ago, created a question with more than 1,000 views. For Pulse information of PacBio data
Popular Question 2.1 years ago, created a question with more than 1,000 views. For Pulse information of PacBio data
Popular Question 2.1 years ago, created a question with more than 1,000 views. For PacBio data assembly with Celera
Popular Question 2.5 years ago, created a question with more than 1,000 views. For Pulse information of PacBio data
Popular Question 2.8 years ago, created a question with more than 1,000 views. For Extract gff of a particular chromosome
Popular Question 3.1 years ago, created a question with more than 1,000 views. For Pulse information of PacBio data
Popular Question 3.3 years ago, created a question with more than 1,000 views. For Pulse information of PacBio data
Popular Question 4.6 years ago, created a question with more than 1,000 views. For Pulse information of PacBio data
Popular Question 4.6 years ago, created a question with more than 1,000 views. For PacBio data assembly with Celera

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1126 users visited in the last hour
_