Admin: Istvan Albert

gravatar for Istvan Albert
Istvan Albert ♦♦ 81k
University Park, USA
Scholar ID:
Google Scholar Page
Last seen:
2 days, 6 hours ago
10 years ago

I have published research works in the fields of granular matter physics, network sciencemachine learninguser interfaces and bioinformatics. But above all I like to create useful systems. I  enjoy the process of designing and implementing web based services that stand the test of time. My current project that I dedicate most my time to is an e-book on genomic data analysis:

  • The Biostar Handbook - it is modeled by the content on this site and is a comprehensive guide for beginning bioinformaticians.

I am the  maintainer of this site:

  • Biostar Q&A platform  more of a jack-of-all-trades:  lead developer, interface designer, database manager, sys admin, dev-ops etc. whatever needs to be done.

Currently I work as a  Professor of Bioinformatics at Penn State. Within that position I serve in various roles:

Posts by Istvan Albert

<prev • 4,674 results • page 1 of 468 • next >
Answer: C: How can I get in touch with a Biostars admin? Need email change.
... The way to do it is to go to your user account and change your email. In addition, you may click on the **about** link and will show the `` email for contact. ...
written 29 days ago by Istvan Albert ♦♦ 81k
Answer: A: Multiple alignment software
... An important detail that should be mentioned here is that none of the alignments you present there are inherently "good" or "bad" Alignment algorithms maximize a score. The result (if implemented correctly) is the alignment that produces the maximal score. The score is built from the rewards and pe ...
written 5 weeks ago by Istvan Albert ♦♦ 81k
Answer: A: jellyfish kmer counting discrepancy
... The better tool to verify patterns that will include overlapping matches is the [dreg][dreg] tool from emboss cat NC_001798.fa | dreg -filter -pattern GGGCGGGGGTCGGGCGGGCGGGGGTCGGGCG [dreg]: produces 13 matches #=============== ...
written 5 weeks ago by Istvan Albert ♦♦ 81k
Comment: C: What is the state of the art in gene set analysis in 2019?
... They (the Avi Mayan' lab) have also built Enrichr, Clustergrammer, and other tools: ...
written 5 weeks ago by Istvan Albert ♦♦ 81k
Comment: C: What is the state of the art in gene set analysis in 2019?
... The clusterprofiler seems like a quite sophisticated tool - a bit overcomplicated in that it is not clear what data goes into it, so one has devote quite the effort to get their data in the right shape and form - but after that looks like it does quite a bit ...
written 5 weeks ago by Istvan Albert ♦♦ 81k
8 follow
What is the "state of the art" in gene set analysis in 2019?
... I am trying to catch up with the latest development in the gene set enrichment analysis and I am looking for recommendations describing practices and approaches that I might have missed. Perhaps older methods are still the best. Here is the question: Suppose you ran an analysis pipeline that produ ...
pathway enrichment go written 5 weeks ago by Istvan Albert ♦♦ 81k
Comment: C: How to run pygraphviz on macOS in conda
... I want to mention here that conda activation works differently starting with conda 4.6 they have removed the `source activate` approach and replaced it with `conda activate` For the original poster I would r ...
written 7 weeks ago by Istvan Albert ♦♦ 81k
Answer: A: Create a gold standard
... Here is a relevant publication: [Is it time to change the reference genome][1]? In a nutshell, my takeaway is that "gold standard" is not the right nomenclature. We should be thinking about a consensus sequence where every base is a major allele. * ...
written 8 weeks ago by Istvan Albert ♦♦ 81k
Comment: C: The Biostar Handbook. A bioinformatics e-book for beginners.
... Hello - your suggestion to list additional learning resources after each chapter is excellent. We will add that over the next semester. On new chapters, it is a bit of a challenge to figure out what to cover next. PacBio, single-cell RNA-Seq and metagenomics are a ...
written 9 weeks ago by Istvan Albert ♦♦ 81k
Comment: C: The Biostar Handbook. A bioinformatics e-book for beginners.
... Thanks for the feedback. For what is worth, I think that BASH prompt is best that I found - though I may have not properly explained why you'd want that information. I will be updating that section to include the following: The bash prompt should give you information on the context that you are w ...
written 11 weeks ago by Istvan Albert ♦♦ 81k

Latest awards to Istvan Albert

Gold Standard 4 days ago, created a post with more than 25 bookmarks. For Table Of Contents To All Review Paper Compilations On Biostar
Good Answer 5 days ago, created an answer that was upvoted at least 5 times. For A: How to align Trimmomatic unpaired reads with BWA?
Teacher 7 days ago, created an answer with at least 3 up-votes. For A: Do You Like Ipython Notebook?
Scholar 12 days ago, created an answer that has been accepted. For A: How to align Trimmomatic unpaired reads with BWA?
Scholar 12 days ago, created an answer that has been accepted. For A: Is it allowed to make a derivative work of the BioStar Handbook in another progr
Scholar 18 days ago, created an answer that has been accepted. For A: Is it allowed to make a derivative work of the BioStar Handbook in another progr
Great Question 5 weeks ago, created a question with more than 5,000 views. For Heng Li of BWA and Samtools uses this
Teacher 6 weeks ago, created an answer with at least 3 up-votes. For A: Improved Peer Review Of Rna-Seq Bioinformatics In Science Publications
Teacher 8 weeks ago, created an answer with at least 3 up-votes. For A: Improved Peer Review Of Rna-Seq Bioinformatics In Science Publications
Librarian 3 months ago, created a post with more than 10 bookmarks. For Table Of Contents To All Review Paper Compilations On Biostar
Commentator 3 months ago, created a comment with at least 3 up-votes. For C: Should I Do A Dual Master Degree In Both Bioinformatics And Cs?
Scholar 3 months ago, created an answer that has been accepted. For A: Is it allowed to make a derivative work of the BioStar Handbook in another progr
Great Question 3 months ago, created a question with more than 5,000 views. For Heng Li of BWA and Samtools uses this
Good Answer 3 months ago, created an answer that was upvoted at least 5 times. For A: How to align Trimmomatic unpaired reads with BWA?
Good Answer 4 months ago, created an answer that was upvoted at least 5 times. For A: Which Are The Best Programming Languages For A Bioinformatician?
Good Answer 4 months ago, created an answer that was upvoted at least 5 times. For A: Which Are The Best Programming Languages For A Bioinformatician?


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2630 users visited in the last hour