Moderator: Alex Reynolds

gravatar for Alex Reynolds
Alex Reynolds23k
Reputation:
23,470
Status:
Trusted
Location:
Seattle, WA USA
Website:
http://dropbit.com/
Twitter:
AlexReynolds
Scholar ID:
Google Scholar Page
Last seen:
8 hours ago
Joined:
8 years, 5 months ago
Email:
a************@gmail.com

One of the developers behind the fast BEDOPS suite, whose pug Zac is the bestest pug in the world.

Posts by Alex Reynolds

<prev • 2,084 results • page 1 of 209 • next >
0
votes
2
answers
115
views
2
answers
Comment: C: How to get million target snps info(ie. chromosome, location) in a easy way?
... You need a file of IDs, stored in the file `rsIDs.txt` (for example). ...
written 11 hours ago by Alex Reynolds23k
0
votes
1
answer
101
views
1
answers
Answer: A: getting a combination of all predicted genes
... Union with `bedops -u` and perhaps filter the unioned set by overlap with `bedmap --range` or `bedmap --echo-overlap-size` operations, piping to `awk` to print qualifying records. I have to admit that the logic is a bit unclear to me but that's perhaps where I might start. ...
written 17 hours ago by Alex Reynolds23k
0
votes
2
answers
115
views
2
answers
Answer: A: How to get million target snps info(ie. chromosome, location) in a easy way?
... One way to do this is via the command line. You could download SNP annotations via `wget`. For example: $ wget -qO- ftp://ftp.ncbi.nih.gov/snp/organisms/human_9606_b151_GRCh37p13/VCF/common_all_20180423.vcf.gz | gunzip -c | convert2bed --input=vcf --output=bed --sort-tmpdir=${PWD} - > hg19.s ...
written 17 hours ago by Alex Reynolds23k
0
votes
1
answer
71
views
1
answers
Answer: A: sort suitable overlap base by using bedtools intersect
... If you want to require a minimum threshold of overlap between elements in reference and map sets, you could do the following: $ bedops --element-of 10 reference.bed map.bed > answer.bed The file `answer.bed` will contain elements in `reference.bed` which overlap elements in `map.bed` by ten ...
written 19 hours ago by Alex Reynolds23k
0
votes
3
answers
111
views
3
answers
Comment: C: Selecting defined length fasta sequence and excluding them from a dataset
... Install and use Cygwin or VirtualBox to install Linux on your Windows host, and use Linux to do your filtering. ...
written 20 hours ago by Alex Reynolds23k
0
votes
3
answers
111
views
3
answers
Comment: C: Selecting defined length fasta sequence and excluding them from a dataset
... Don't include the `$` character. That character is there just to remind you that this is a command-line task. ...
written 20 hours ago by Alex Reynolds23k
0
votes
3
answers
111
views
3
answers
Comment: C: Selecting defined length fasta sequence and excluding them from a dataset
... Is it incorrect? $ awk '!/^>/ { next } { getline seq } length(seq) > 35 { print $0 "\n" seq "\n" length(seq) }' /tmp/in.fa >sequence_ID_1 atcgatcgggatcaatgacttcattggagaccgaga 36 >sequence_ID_2 gatccatggacgtttaacgcgatgacatactaggatcagat 41 Seems like the filte ...
written 20 hours ago by Alex Reynolds23k
0
votes
4
answers
113
views
4
answers
Comment: C: Parsing dataframe and sort a fasta file
... I do not have a paper on this, I'm sorry. I'm just relating past experience processing FASTA files with this library. ...
written 22 hours ago by Alex Reynolds23k
0
votes
3
answers
2.5k
views
3
answers
Comment: C: Search dbSNP for hg19 based coordinates
... I think my previous answer was inaccurate in that it did not adjust the start and stop positions to 0-based, half-open indexing. I updated my answer to use the current VCF file from NCBI, using `convert2bed` to convert from VCF to BED with the correct coordinate system adjustment. It is probably bet ...
written 22 hours ago by Alex Reynolds23k
0
votes
3
answers
111
views
3
answers
Answer: C: Selecting defined length fasta sequence and excluding them from a dataset
... Here's an `awk`-based approach, if your FASTA records are single-lined (header on one line, sequence on the next line, and so on): $ awk '!/^>/ { next } { getline seq } length(seq) > 100 { print $0 "\n" seq }' input.fa > output.fa If multi-lined (header on one line, sequence split acr ...
written 23 hours ago by Alex Reynolds23k

Latest awards to Alex Reynolds

Teacher 2 days ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Teacher 6 days ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Teacher 7 days ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 10 days ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Scholar 10 days ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Popular Question 18 days ago, created a question with more than 1,000 views. For Tips On Compiling And Using Meme 4.3 With A Sun Grid Engine Computation Cluster
Teacher 19 days ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 19 days ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Teacher 19 days ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 19 days ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Scholar 20 days ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Appreciated 25 days ago, created a post with more than 5 votes. For Rosalind
Teacher 26 days ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 4 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Scholar 4 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 5 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Teacher 6 weeks ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 7 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Teacher 9 weeks ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 9 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Teacher 10 weeks ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2086 users visited in the last hour