Moderator: Alex Reynolds

gravatar for Alex Reynolds
Alex Reynolds29k
Reputation:
28,760
Status:
Trusted
Location:
Seattle, WA USA
Website:
http://bitsumma.com/
Twitter:
AlexReynolds
Scholar ID:
Google Scholar Page
Last seen:
3 hours ago
Joined:
9 years, 11 months ago
Email:
a************@gmail.com

One of the developers behind the fast BEDOPS suite, whose pug Zac is the bestest pug in the world.

Posts by Alex Reynolds

<prev • 2,444 results • page 1 of 245 • next >
1
vote
1
answer
43
views
1
answers
Answer: A: Data clustering / matching enteries
... If you need items presented as found in their original order: $ awk '{ arr[$1] = arr[$1]"|"$0; } END{ for (k in arr) { s=arr[k]; n=split(s,a,"|"); for (i=2;i<=n;i++) { print a[i]; } print ""; } }' entries.txt A 1 2 3 4 5 6 A 11 232 4 6 7 8 A 0 0 0 0 0 0 B 2 4 54 34 3 1 ...
written 3 hours ago by Alex Reynolds29k
0
votes
2
answers
63
views
2
answers
Answer: A: Python- Searching codons using for/if
... Use `re` to find the start index positions of all instances of your string-of-interest (here, your start codon, or whatever). $ python >>> import re >>> [m.start() for m in re.finditer('ATG', 'ATGCGATCGATCGATCGATCGCGCGCGCAGCTA')] [0] Replace with `ATGCGATCGATCGAT ...
written 6 hours ago by Alex Reynolds29k
3
votes
0
answers
112
views
0
answers
Comment: C: how to create a scatter plot as shown
... Read up on ggplot, log-linear and log-log plots, and regression. ...
written 7 days ago by Alex Reynolds29k
2
votes
3
answers
134
views
3
answers
Answer: A: Get SVG image of motif
... You could perhaps use Inkscape to import EPS and export SVG: https://inkscape.org/learn/faq/#what-formats-can-inkscape-importexport ...
written 16 days ago by Alex Reynolds29k
1
vote
4
answers
299
views
4
answers
Answer: A: Python FASTA scripting
... One approach I'd suggest uses standard input. This makes it very easy to test out different inputs: #!/usr/bin/env python import sys import re import os import errno sequence = "" for line in sys.stdin: line = line.rstrip() if line.startswith('>' ...
written 19 days ago by Alex Reynolds29k
0
votes
4
answers
299
views
4
answers
Comment: C: Python FASTA scripting
... Counterpoint: Biopython is slow, and learning to parse files with Python is an invaluable skill. It's a decent exercise for a beginning bioinformatician or someone learning Python. ...
written 19 days ago by Alex Reynolds29k
0
votes
1
answer
111
views
1
answers
Comment: C: Transcription factor binding site prediction
... But without TF models from JASPAR or other sources, this is kind of a useless answer. Hopefully the OP can get in touch with some plant-specific TF specialists who can help him or her get the TF models needed to do this (on whatever scale). ...
written 19 days ago by Alex Reynolds29k
0
votes
1
answer
111
views
1
answers
Comment: C: Transcription factor binding site prediction
... Could you review approaches here: http://planttfdb.cbi.pku.edu.cn/index.php?sp=Vun and here: https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-017-4306-1 for TF discovery? You might even contact authors for advice and code, to set up a collaboration to run things for your particular spec ...
written 19 days ago by Alex Reynolds29k
0
votes
1
answer
111
views
1
answers
Comment: C: Transcription factor binding site prediction
... Depends on your experiment, I guess. A reference genome rarely changes, but targets could easily do so. You only have to scan a reference genome once to build a "database" of binding sites. If your targets change, all you have to do is scan with `bedops` etc. against the reference binding sites, whi ...
written 19 days ago by Alex Reynolds29k
4
votes
1
answer
111
views
1
answers
Answer: A: Transcription factor binding site prediction
... You could run FIMO on your entire genome for TFs (transcription factors; DNA-binding proteins) of interest, which gives you binding sites: genomic intervals where those TFs bind. Here's a post where I wrote up step-by-step instructions: https://bioinformatics.stackexchange.com/a/2491/776 Once you ...
written 19 days ago by Alex Reynolds29k

Latest awards to Alex Reynolds

Appreciated 6 days ago, created a post with more than 5 votes. For samtools idxstats on indexed BAM failed
Teacher 10 days ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 12 days ago, created an answer that has been accepted. For A: No PhyloP score for first stretch of chromosome?
Scholar 12 days ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Scholar 14 days ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Scholar 15 days ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Teacher 18 days ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Great Question 18 days ago, created a question with more than 5,000 views. For Tips On Compiling And Using Meme 4.3 With A Sun Grid Engine Computation Cluster
Teacher 4 weeks ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 4 weeks ago, created an answer that has been accepted. For A: No PhyloP score for first stretch of chromosome?
Scholar 4 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Scholar 5 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Scholar 7 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Teacher 12 weeks ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 12 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Scholar 12 weeks ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Appreciated 3 months ago, created a post with more than 5 votes. For A: Find Nearest Gene Upstream Using Mysql And Perl Program
Scholar 3 months ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 3 months ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper
Epic Question 3 months ago, created a question with more than 10,000 views. For Converting TCGA expression data from FPKM to TPM
Good Answer 3 months ago, created an answer that was upvoted at least 5 times. For A: Find Nearest Gene Upstream Using Mysql And Perl Program
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: How To Intersect Two Tracks In Ucsc Table Browser And Get Fields From Both?
Scholar 4 months ago, created an answer that has been accepted. For A: Do these warning messages during my bedops install mean bedops won't work proper

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2123 users visited in the last hour