User: Dave Carlson

gravatar for Dave Carlson
Dave Carlson290
Reputation:
290
Status:
Trusted
Location:
Stony Brook University, NY
Last seen:
16 hours ago
Joined:
3 years, 10 months ago
Email:
d*******************@gmail.com

Posts by Dave Carlson

<prev • 48 results • page 1 of 5 • next >
0
votes
0
answers
71
views
0
answers
Comment: C: Assembling haplotypes of a highly heterozygous gene cluster with canu
... I don't have any good suggestions for additional Canu parameters to tweak, but have you tried the latest version of the Platanus assembler? It's designed for heterozgous genome assembly, and uses both long and short-read data. See more here: https://www.nature.com/articles/s41467-019-09575-2 ...
written 11 days ago by Dave Carlson290
0
votes
0
answers
125
views
0
answers
Comment: C: Salmon RNA-seq quantification for repeated genome
... Nothing obvious to me. It might be worth running salmonTE and salmon on the same dataset (using a set of retrotransposons as the reference) and see if the results differ substantively. ...
written 13 days ago by Dave Carlson290
0
votes
0
answers
125
views
0
answers
Comment: C: Salmon RNA-seq quantification for repeated genome
... If you have a database of repeats for your organism, you might want consider using either [SalmonTE][1] or [TETranscripts][2] [1]: https://github.com/LiuzLab/SalmonTE [2]: https://github.com/mhammell-laboratory/TEtranscripts ...
written 14 days ago by Dave Carlson290
1
vote
1
answer
70
views
1
answers
Comment: C: How should I use skewer to trim paired end reads?
... I'll second this suggestion and throw in an additional plug for [fastp][1], which is also multi-threaded. [1]: https://github.com/OpenGene/fastp ...
written 18 days ago by Dave Carlson290
1
vote
2
answers
146
views
2
answers
Answer: A: GATK multiple samples
... You need to run HaplotypeCaller individually for each of your bam files using the "-ERC GVCF" flag. This will produce once gvcf file for each of your bam files. Then you would combine each of the GVCF files produced by HaplotypeCaller (e.g., with gatk's CombineGVCFs tool) into a single GVCF file. ...
written 5 weeks ago by Dave Carlson290
2
votes
0
answers
110
views
0
answers
Comment: C: How to make a phylogenetic tree set in ASTRAL?
... I think you will need to be more specific about your data and your goals. ASTRAL takes gene trees as input and uses these to estimate a species tree under the multi-species coalescent model (or at least a heuristic approximation). Therefore, to run ASTRAL, you would need to first infer phylogenies ...
written 6 weeks ago by Dave Carlson290
0
votes
0
answers
185
views
0
answers
Comment: C: Why wont my newick file from MEGA open in FigTree?
... You can try pasting the text of your tree file into an online viewer (e.g., [ETE Toolkit][1]), but as https://www.biostars.org/u/20598/ said, there is probably an issue with the format of the file, you should view it in a text editor. [1]: http://etetoolkit.org/treeview/ ...
written 6 weeks ago by Dave Carlson290
3
votes
2
answers
137
views
2
answers
Answer: A: Removing the last part of fasta header in many alignmnet files
... Your loop doesn't supply sed with a file to modify. This should work: for filename in *.FNA; do sed '/>/ s/\(.*\)-.*$/\1/g' $filename; done ...
written 6 weeks ago by Dave Carlson290
1
vote
0
answers
149
views
0
answers
Comment: C: how to use Ka/Ks calculator
... Are you referring to the Ka/Ks calculator found here? [https://kakscalculator.herokuapp.com/][1] [1]: https://kakscalculator.herokuapp.com/ ...
written 7 weeks ago by Dave Carlson290
1
vote
1
answer
119
views
1
answers
Answer: A: Remove and Substitute Fasta Header
... How about: sed 's/^>[A-Z0-9]\+.[0-9] Archilochus alexandri />BCH /' seq.fasta > new_seq.fasta Using your examples, this will produce: >BCH voucher B02923 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial GGCTGGAATAGTTGGAACCTCTCTAAGCCTACTAATCCGAGCGGAACTCGG ...
written 7 weeks ago by Dave Carlson290

Latest awards to Dave Carlson

Voter 18 days ago, voted more than 100 times.
Teacher 6 weeks ago, created an answer with at least 3 up-votes. For A: Up-to-date Online RNA Sequence Analysis Training/Courses/Papers?
Teacher 10 weeks ago, created an answer with at least 3 up-votes. For A: Up-to-date Online RNA Sequence Analysis Training/Courses/Papers?
Scholar 10 weeks ago, created an answer that has been accepted. For A: Genome duplication assessment
Popular Question 7 months ago, created a question with more than 1,000 views. For codeml jobs taking much longer on a server than on an imac
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: Up-to-date Online RNA Sequence Analysis Training/Courses/Papers?
Supporter 7 months ago, voted at least 25 times.
Popular Question 15 months ago, created a question with more than 1,000 views. For RepeatModeler finishes without creating output files
Teacher 2.2 years ago, created an answer with at least 3 up-votes. For A: Up-to-date Online RNA Sequence Analysis Training/Courses/Papers?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 853 users visited in the last hour