User: k.kathirvel93

gravatar for k.kathirvel93
k.kathirvel93250
Reputation:
250
Status:
Trusted
Location:
India
Last seen:
6 hours ago
Joined:
4 years, 1 month ago
Email:
k************@gmail.com

Posts by k.kathirvel93

<prev • 161 results • page 1 of 17 • next >
0
votes
1
answer
61
views
1
answers
Comment: C: How to extract sequences from multi fasta file, which contains specific primers?
... @cpad0112 Can you help with this thread? ...
written 5 hours ago by k.kathirvel93250
2
votes
1
answer
38
views
1
answer
Sort header from the multifasta sequnce file into only gene name
... I have multifasta protein sequences with long headings, but i want to exclude everything and keep only gene name which appears after 'GN= '. Can anyone help with this pls.... >sp|P0AGM2|YICG_ECOLI UPF0126 inner membrane protein YicG OS=Escherichia coli (strain K12) OX=83333 GN=yicG PE=1 SV=1 M ...
genome alignment sequence gene sequencing written 8 hours ago by k.kathirvel93250 • updated 6 hours ago by gayachit170
0
votes
1
answer
61
views
1
answers
Comment: C: How to extract sequences from multi fasta file, which contains specific primers?
... Thanks @cpad0112, it worked nice, but i need one more help. I got few reads after this filter, which contains more reads after the reverse primer sequence 'gtgattagttagacgcgtgctagaggc', So i want to eliminate those reads (reads after the reverse primer sequence) and keep only reads present in betwe ...
written 1 day ago by k.kathirvel93250
3
votes
1
answer
61
views
1
answer
How to extract sequences from multi fasta file, which contains specific primers?
... Hi EveryOne, I have a multifasta file which is converted from BWA bam file. I want to extract only sequences contains specific forward primer on the start and reverse primer at the end. How can i do it with awk or sed or grep. Thanks in advance. The Input file looks like this : >M01015:63 ...
genome assembly next-gen sequence sequencing written 1 day ago by k.kathirvel93250 • updated 1 day ago by karl.stamm3.6k
0
votes
2
answers
84
views
2
answers
Comment: C: How to extract sequences from multi fasta file, which contains specific primers?
... Thanks for the reply genomax. I have made few changes in the question, so will you help with that? ...
written 2 days ago by k.kathirvel93250
0
votes
2
answers
84
views
2
answers
Comment: C: How to extract sequences from multi fasta file, which contains specific primers?
... Thanks for the reply cpad0112. I have made few changes in the question, so will you help with that? ...
written 2 days ago by k.kathirvel93250
0
votes
0
answers
195
views
0
answers
How to label Phage, resistance and virulence genes name in BRIG blast ring ?
... Hi EveryOne, How to label Phage, resistance and virulence genes name in BRIG blast ring like this : [BRIG][1] [1]: https://www.google.co.in/search?q=brig%20blast%20ring%20image&hl=en&source=lnms&tbm=isch&sa=X&ved=0ahUKEwjVt4GhyZXiAhXJM48KHfc8AFYQ_AUIDigB&biw=1861 ...
genome gene next-gen sequence sequencing written 10 months ago by k.kathirvel93250
0
votes
0
answers
284
views
0
answers
Comment: C: convert entrez ID to miRNA
... Why don't you try STAR and FeatureCounts then DESEQ2 ? ...
written 11 months ago by k.kathirvel93250
0
votes
0
answers
284
views
0
answers
Comment: C: convert entrez ID to miRNA
... Which tool you are using for Quantification? ...
written 11 months ago by k.kathirvel93250
0
votes
0
answers
198
views
0
answers
Can anyone suggest me "How to predict smallRNAs from p.aeruginosa whole genome data"?
... Hi EveryOne, I Have 5 *P.aeruginosa* Complete NGS whole genome data and I am trying predict smallRNAs from it. The raw data was assembled and annotated. Already I tried BSRD I got 80 smallRNAs but the database was updated very long back. So, now I trying manually, till now I have extracted intergen ...
genome next-gen sequence sequencing written 11 months ago by k.kathirvel93250 • updated 10 months ago by Biostar ♦♦ 20

Latest awards to k.kathirvel93

Great Question 7 months ago, created a question with more than 5,000 views. For What is the exact definition for scaffold?
Popular Question 7 months ago, created a question with more than 1,000 views. For how to open mauve .tree file in ubuntu 14.04?
Popular Question 7 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 7 months ago, created a question with more than 1,000 views. For how can i install ITEP on my ubuntu 14.04?
Popular Question 7 months ago, created a question with more than 1,000 views. For Sort Sequences In A Fasta File According To The peg List
Popular Question 7 months ago, created a question with more than 1,000 views. For How can I Annotate my miRNA data against MirBase?
Popular Question 7 months ago, created a question with more than 1,000 views. For Where can i download Pseudomonas aeruginosa Drug resistance mutations database?
Popular Question 7 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Student 7 months ago, asked a question with at least 3 up-votes. For How to convert transcript level TPM to gene level TPM ?
Popular Question 9 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 9 months ago, created a question with more than 1,000 views. For how can i install ITEP on my ubuntu 14.04?
Popular Question 9 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 9 months ago, created a question with more than 1,000 views. For Sort Sequences In A Fasta File According To The peg List
Popular Question 9 months ago, created a question with more than 1,000 views. For Ubuntu 14.04 automatically going to power saving mode?
Popular Question 10 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 10 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 12 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 13 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 14 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 14 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 15 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 17 months ago, created a question with more than 1,000 views. For How to get contigs from scaffolds
Voter 17 months ago, voted more than 100 times.
Scholar 18 months ago, created an answer that has been accepted. For A: Aligning Contigs of various Mtb strains to a reference genome and get the varian
Popular Question 18 months ago, created a question with more than 1,000 views. For How to get contigs from scaffolds

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 920 users visited in the last hour