User: k.kathirvel93

gravatar for k.kathirvel93
k.kathirvel93120
Reputation:
120
Status:
Trusted
Location:
India
Last seen:
2 hours ago
Joined:
2 years, 8 months ago
Email:
k************@gmail.com

Posts by k.kathirvel93

<prev • 114 results • page 1 of 12 • next >
0
votes
0
answers
81
views
0
answers
Comment: C: How to run eXpress RNA-seq quantification?
... Hi Charles Warden, I am happy about your reply, and now i got some idea. Can you suggest me where can i download that transcriptome FA file. I have .gtf annotation file. ...
written 5 days ago by k.kathirvel93120
0
votes
0
answers
81
views
0
answers
Comment: C: How to run eXpress RNA-seq quantification?
... Yes. For specific area of disease. ...
written 5 days ago by k.kathirvel93120
2
votes
0
answers
81
views
0
answers
How to run eXpress RNA-seq quantification?
... Hi EveryOne, I am trying to benchmark RNA-seq quantification tools, While trying eXpress, i donno how to finished it up coz of reference and bam file confusion. I have aligned my paired-end RNA-seq data with Hisat2 and STAR. Can anyone suggest me a code for eXpress quantification. It ll be so helpf ...
gene next-gen rna-seq written 5 days ago by k.kathirvel93120
0
votes
1
answer
210
views
1
answers
Comment: C: RNA seq normalization(TMM)
... I suspect that you have a problem on write.csv line. Check your path is correct or not. ...
written 20 days ago by k.kathirvel93120
0
votes
1
answer
210
views
1
answers
Comment: C: RNA seq normalization(TMM)
... library(edgeR) #TMM Normalisation lib.size <- sum(d$sample1) scale.factors <- calcNormFactors(TMM$sample1, method = "TMM") norm.data <- t(t(TMM$sample1)/(scale.factors*lib.size)) write.csv(norm.data,"/home/TMM.csv") ...
written 21 days ago by k.kathirvel93120
0
votes
0
answers
177
views
0
answers
Comment: C: How can i get gene name instead of gene ID from prepDE.py after STRINGtie?
... Hi arshad1292, I found the way by myself, First go to normal stringtie gene abundance file and reorder the ensemblID column in alphabet order with extent selection and copy gene ID column. Second go to PrepDE.py output file gene_Count_matrix.csv, and reorder the ensemblID column in alphabet orde ...
written 24 days ago by k.kathirvel93120
0
votes
1
answer
113
views
1
answers
Comment: C: HISAT2 alignment Error?
... Should I do something for this warning OR i can go further ?. Because after this, i am getting more than 95 % alignment rate. Thanks ...
written 4 weeks ago by k.kathirvel93120
0
votes
1
answer
113
views
1
answers
Comment: C: HISAT2 alignment Error?
... Thanks for the reply ATpoint, Here is my Adapter removal command: cutadapt3 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -o Sample_1.fastq -p Sample_2.fastq Sample1_1fastq Sample1_2.fastq I am not getting any warning, while aligning w ...
written 4 weeks ago by k.kathirvel93120
1
vote
1
answer
113
views
1
answer
HISAT2 alignment Error?
... Hi EveryOne, I am working in Paired-wnd RNA-seq data set, When i am trying to align my reads against reference HG19 genome by using HISAT2, am getting this error: Warning: skipping mate #2 of read 'ST-E00142:733:HTKKMCCXY:1:1207:16163:5229 2:N:0:ACTTGA' because it was < 2 characters long T ...
software error assembly next-gen rna-seq written 4 weeks ago by k.kathirvel93120
0
votes
2
answers
167
views
2
answers
Answer: A: STAR set --sjdbOverhang value
... Why don't you use sjdbOverhang 101 for your 150bp paired-end data? ...
written 5 weeks ago by k.kathirvel93120

Latest awards to k.kathirvel93

Scholar 10 days ago, created an answer that has been accepted. For A: Aligning Contigs of various Mtb strains to a reference genome and get the varian
Popular Question 27 days ago, created a question with more than 1,000 views. For How to get contigs from scaffolds
Scholar 8 weeks ago, created an answer that has been accepted. For A: Aligning Contigs of various Mtb strains to a reference genome and get the varian
Centurion 9 weeks ago, created 100 posts.
Popular Question 4 months ago, created a question with more than 1,000 views. For Sort Sequences In A Fasta File According To The peg List
Popular Question 8 months ago, created a question with more than 1,000 views. For How to get contigs from scaffolds
Supporter 12 months ago, voted at least 25 times.
Popular Question 14 months ago, created a question with more than 1,000 views. For What is the exact definition for scaffold?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1080 users visited in the last hour