User: k.kathirvel93

gravatar for k.kathirvel93
k.kathirvel93260
Reputation:
260
Status:
Trusted
Location:
India
Last seen:
2 months, 3 weeks ago
Joined:
4 years, 5 months ago
Email:
k************@gmail.com

Posts by k.kathirvel93

<prev • 170 results • page 1 of 17 • next >
0
votes
2
answers
181
views
2
answers
Comment: C: How to remove sequence reads contains more than 1 X from multifasta file?
... Thanks for the advice. > Here you asked how to remove sequences containing N characters ? Still i didn't get any solution for this, which is why i came up with a new thread. i tried with googlong also, but i couldn't get any. If i am better in scripting i could've done by myself. Taking ideas ...
written 3 months ago by k.kathirvel93260
0
votes
2
answers
181
views
2
answers
Comment: C: How to remove sequence reads contains more than 1 X from multifasta file?
... Hi Mr. Pierre Lindenbaum, Thanks for the fast reply, your awk script is removing fine reads( with no X) also. can you help again. and also i made few changes on my question, can you help with this modified thread ? ...
written 3 months ago by k.kathirvel93260
8
votes
2
answers
181
views
5 follow
2
answers
How to remove sequence reads contains more than 1 X from multifasta file?
... I have 5000 protein sequences in one multifasta file. I found more reads have gaps as X in their reads. So, want to eliminate those reads completely (Whole protein seq) from the file. I am keeping filter criteria as if a read contains morethan 2 X ( continuesly or anywhere in the read) should be rem ...
sequence sequencing written 3 months ago by k.kathirvel93260 • updated 3 months ago by manojkumarbioinfo60
1
vote
1
answer
200
views
1
answer
Phylogenetic tree construction from MAFFT aligned large genome dataset ?
... Hi EveryOne, I have MSA file of 11000 genomes (30k size each) aligned by MAFFT. I want to construct a phylogenetic tree from this large MSA file (500megabytes). I tried MEGAX and RAxML but, it takes so long and at last it got crashed in my ubuntu 16.04, 8GB RAM and 1TB HD workstation. So, can anyon ...
genome alignment sequence written 3 months ago by k.kathirvel93260 • updated 3 months ago by Anand Rao310
0
votes
0
answers
88
views
0
answers
Comment: C: how to remove specific sequences from multi-fasta file which contains N ?
... Thanks @Pierre Lindenbaum, I have gone through that thread you mentioned, but it was not working fine with my large data, coz after executed that code, still the genome have Ns. Since that thread was 4 yrs old, i created my own thread. Can you help with this? Thanks ...
written 3 months ago by k.kathirvel93260
0
votes
0
answers
88
views
0
answers
how to remove specific sequences from multi-fasta file which contains N ?
... Hi EveryOne, I have a multifasta file which contains 11000 (30kb each) genomes. Now i want to remove all the reads(whole genome) which contains N (minimum atleast one N ). How can I do this with sed or awk? Thanks in advance. I have input like this : >Genome1 ATCGTCGTACAGATACAGATACANNNcGATAGAC ...
genome sequence alignment sequencing written 3 months ago by k.kathirvel93260
0
votes
0
answers
70
views
0
answers
extract only reads repeated more than 10 times from BLASTp excel sheet output
... Hi EveryOne, I have BLASTp output which contains 8 columns, the 3rd column contains repeated aminiacid sequences one cell by one cell. Now i want to extract only reads which is repeated more than 10 times in 3rd column (along with other 7 columns). thanks. Sorry for not giving any examples, because ...
assembly sequence alignment written 3 months ago by k.kathirvel93260
0
votes
0
answers
40
views
0
answers
Comment: C: How to perform BLASTp with two multifasta protein sequence files?
... I tried a lot, but always end up with problems. Thanks ...
written 4 months ago by k.kathirvel93260
0
votes
1
answer
250
views
1
answers
Comment: C: How to extract sequences from multi fasta file, which contains specific primers?
... Thanks @cpad0112, by the mistake you have taken both my input and expected output in one single file and you filtered the expected output sequence alone. but clearly.... Input reads are like M01015:63:000000000-D2M18:1:1102:14195:28796 GGCACTCGTATCGATGCGGCCGCGGTAAACTCCACCCGGAGCAAGGCCAAATAGGGGTTCAT ...
written 4 months ago by k.kathirvel93260
0
votes
1
answer
250
views
1
answers
Comment: C: How to extract sequences from multi fasta file, which contains specific primers?
... @cpad0112 Can you help with this thread? ...
written 4 months ago by k.kathirvel93260

Latest awards to k.kathirvel93

Great Question 11 months ago, created a question with more than 5,000 views. For What is the exact definition for scaffold?
Popular Question 11 months ago, created a question with more than 1,000 views. For how to open mauve .tree file in ubuntu 14.04?
Popular Question 11 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 11 months ago, created a question with more than 1,000 views. For how can i install ITEP on my ubuntu 14.04?
Popular Question 11 months ago, created a question with more than 1,000 views. For Sort Sequences In A Fasta File According To The peg List
Popular Question 11 months ago, created a question with more than 1,000 views. For How can I Annotate my miRNA data against MirBase?
Popular Question 11 months ago, created a question with more than 1,000 views. For Where can i download Pseudomonas aeruginosa Drug resistance mutations database?
Popular Question 11 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Student 11 months ago, asked a question with at least 3 up-votes. For How to convert transcript level TPM to gene level TPM ?
Popular Question 14 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 14 months ago, created a question with more than 1,000 views. For how can i install ITEP on my ubuntu 14.04?
Popular Question 14 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 14 months ago, created a question with more than 1,000 views. For Sort Sequences In A Fasta File According To The peg List
Popular Question 14 months ago, created a question with more than 1,000 views. For Ubuntu 14.04 automatically going to power saving mode?
Popular Question 14 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 14 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 17 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 17 months ago, created a question with more than 1,000 views. For How can I compare my CLC denovo variants against BWA+samtools variants?
Popular Question 18 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 18 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 19 months ago, created a question with more than 1,000 views. For How to delete my post in biostars ?
Popular Question 21 months ago, created a question with more than 1,000 views. For How to get contigs from scaffolds
Voter 21 months ago, voted more than 100 times.
Scholar 22 months ago, created an answer that has been accepted. For A: Aligning Contigs of various Mtb strains to a reference genome and get the varian
Popular Question 22 months ago, created a question with more than 1,000 views. For How to get contigs from scaffolds

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1389 users visited in the last hour