User: mathavanbioinfo

Reputation:
50
Status:
Trusted
Location:
India
Website:
https://scholar.google...
Last seen:
1 month ago
Joined:
4 years, 6 months ago
Email:
m**************@gmail.com

Posts by mathavanbioinfo

<prev • 54 results • page 1 of 6 • next >
0
votes
0
answers
104
views
0
answers
(Closed) Problem for installing arrayQualityMetrics package?
... Hello All, I am trying to install the package arrayQualityMetrics Package, I got the error mentioned below library(arrayQualityMetrics) Error: package or namespace load failed for ‘arrayQualityMetrics’ in rbind(info, getNamespaceInfo(env, "S3methods")): number of columns of matrices mu ...
R microarray written 4 weeks ago by mathavanbioinfo50 • updated 4 weeks ago by genomax90k
0
votes
0
answers
129
views
0
answers
Comment: C: How create annotation file for WGCNA for RNA-Seq data?
... Thank you very much for your response I used to follow this protocol https://www.nature.com/articles/nprot.2016.095 at one step I have to make stringTie merge to combine all the samples with the reference annotation file of h38 downloaded from Ensembl ftp. $ stringtie --merge -p 8 -G chrX_data/gene ...
written 12 weeks ago by mathavanbioinfo50
0
votes
0
answers
129
views
0
answers
How create annotation file for WGCNA for RNA-Seq data?
... Hello Biostars, I am currently working on WGCNA analysis for RNA-Seq data, the input gene count matrix files contain Ensemble gene ids and MSTRG ids. Now I want to create the annotation files. I have stringTie merged files, can I use it as annotation file? If possible means that file contains many ...
wgcna rna-seq annotaion file written 12 weeks ago by mathavanbioinfo50 • updated 12 weeks ago by Kevin Blighe65k
0
votes
1
answer
204
views
1
answer
How to make annotation file for WGCNA analysis of RNA Seq data?
... hello all, I want to study the co-expression analysis using RNA seq data by WGCNA analysis ( Organism- Homosapiens). I created the gene count matrix file (Package - Subread ) as the input file. For mapping the Ensemble ID into the gene symbol, I need a **gene annotation file**. Please share your kno ...
next-gen written 5 months ago by mathavanbioinfo50 • updated 5 months ago by Kevin Blighe65k
0
votes
0
answers
187
views
0
answers
lncRNA prediction using CPAT?
... Hello All, I am trying to find the lncRNA using the CPAT, the following error I got Command used **python3 cpat.py -g SRR58075_uix_orf.fa.tar.gz -d Human_logitModel.RData -x Human_Hexamer.tsv -o out.txt** Error message Traceback (most recent call last): File "cpat.py", line 241, in main() ...
cpat lncrna written 6 months ago by mathavanbioinfo50
0
votes
1
answer
257
views
1
answers
Comment: C: CPAT error while analysis
... Hello, I got the same error can you resolve it Sample fasta >MSTRG.1687.1 GGCTTATTCTTTACTTTTTCCCACTTTTCCAGGCTCAGCGGGGAGCTGTTGGATGAGAAAGAGCCTGAAGTCTTGCAGGAGTCACTGGATAGATGCTATTCAACTCCTTCAGGTTGTCTTGAACTGA CTGACTCATGCCAGCCCTACAGAAGTGCCTTTTACATATTGGAGCAACAGCGTGTTGGCTTGGCTGTTGACATGGATG ...
written 6 months ago by mathavanbioinfo50
0
votes
0
answers
224
views
0
answers
DEGS analysis with DESeq2?
... Hello all, I am working in DEG analysis using DESeq2, I followed the protocol given in StringTie, the results file has very **few genes** ( mapped with AnnotationDbi,org.Hs.eg.db), and the genes start with **MSTRG** abundantly present. Is there any way to map MSTRG id gene ids or how to deal with ...
deseq2 degs written 7 months ago by mathavanbioinfo50 • updated 6 months ago by Biostar ♦♦ 20
0
votes
0
answers
162
views
0
answers
DEGs analysis with StringTie results?
... Hello All, I am working on differential gene expression analysis using the stringTie assembly tools. For count matrix, prepDE generating two files **gene_count_matrix** and **transcript_count_matrix**. As per the protocol they have used the gene_count_matix file for the DEGs analysis. Is it possible ...
stringtie degs deseq2 written 7 months ago by mathavanbioinfo50
0
votes
3
answers
540
views
3
answers
Comment: A: construction of draft genome from the contigs
... The genome size approximately 19kb in size ...
written 8 months ago by mathavanbioinfo50
1
vote
2
answers
386
views
2
answers
Comment: A: How to get GTF file for Rousettus_aegyptiacus?
... https://ibb.co/1KQbrB7 ...
written 8 months ago by mathavanbioinfo50

Latest awards to mathavanbioinfo

Popular Question 12 weeks ago, created a question with more than 1,000 views. For Up and Down regulated genes
Scholar 8 months ago, created an answer that has been accepted. For A: How to get GTF file for Rousettus_aegyptiacus?
Popular Question 12 months ago, created a question with more than 1,000 views. For Up and Down regulated genes
Popular Question 15 months ago, created a question with more than 1,000 views. For Up and Down regulated genes
Popular Question 17 months ago, created a question with more than 1,000 views. For Up and Down regulated genes
Popular Question 17 months ago, created a question with more than 1,000 views. For Up and Down regulated genes
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Up and Down regulated genes
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Up and Down regulated genes
Popular Question 3.5 years ago, created a question with more than 1,000 views. For Microarray adata Normalization using GEO2R?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1026 users visited in the last hour