User: ATPoint

gravatar for ATPoint
ATPoint720
Reputation:
720
Status:
Trusted
Location:
Last seen:
9 hours ago
Joined:
1 year, 4 months ago
Email:
a*********@gmail.com

Posts by ATPoint

<prev • 121 results • page 1 of 13 • next >
1
vote
0
answers
83
views
0
answers
Comment: C: Samtools error in novoBreak " [main_samview] region "chrY:13119970-13120970" spe
... The reference fasta uses only the numbers to name the chromosomes, so 1,2,3 instead of chr1, chr2, chr3. You can change that in awk, as [previously][1] suggested:: awk '/^>/{print ">chr" ++i; next}{print}' < foo.fasta [1]: https://www.biostars.org/p/53212/ ...
written 13 hours ago by ATPoint720
0
votes
2
answers
211
views
2
answers
Comment: C: Removal of PCR dupliactes from trimmed reads
... The situation you describe would lead to a low mapping quality during the alignment, probably even 0. Good practice is to discard these reads categorically because, as you say, one cannot distinguish properly. I typically remove duplicates after all the filtering steps. For standard assays like ATAC ...
written 15 hours ago by ATPoint720
0
votes
3
answers
424
views
3
answers
Answer: A: weird insert size post trimming
... Ok, it seems that you have the TruSeq Ribo adapter. You can doublecheck with [this file from Illumina][1], containing the common adapters. In any case, it is not Nextera. Retrim with the proper adapter sequence and the issue should be solved. [1]: https://support.illumina.com/content/dam/illumin ...
written 1 day ago by ATPoint720
0
votes
2
answers
211
views
2
answers
Comment: C: Removal of PCR dupliactes from trimmed reads
... No, as in paired-end, the insert size, which defines the fragment, are solely defined by the 5' ends of the respective fwd and rev reads. Have a look at [this figure][1], you can see that no matter where the 3' ends are (so the arrow heads), the 5' ends are unaffected by this, and so is the insert s ...
written 1 day ago by ATPoint720
1
vote
2
answers
211
views
2
answers
Comment: C: Removal of PCR dupliactes from trimmed reads
... There are two things that you (I think) are mixing up. 1) trimming is done on the fastq files, but rmdup works on aligned data 2) duplicates are defined by the 5' ends of the paired-end data, while trimming takes away bases from the 3' end, so no worries, trimming will not affect duplicate removal ...
written 1 day ago by ATPoint720
0
votes
3
answers
424
views
3
answers
Comment: C: weird insert size post trimming
... Also be sure that the adapter file is correct. CTGTCTCTTATACACATCTCCGAGCCCACGAGAC is what you have to trim for in case that the Nextera adapter was used for library prep (on both strands, same adapter sequence). ...
written 1 day ago by ATPoint720
0
votes
0
answers
215
views
0
answers
Comment: C: NGS compute infrastructure
... Make sure to have sufficient I/O capacity to really make full use of CPU and RAM. The best cluster makes no sense if the I/O bottleneck kills all the performance and permits to use multithreading effectively. ...
written 3 days ago by ATPoint720
0
votes
0
answers
155
views
0
answers
Comment: C: Low Alignment Rate for TT2 Cells
... The bowtie-index is the same for all the different cell lines experiments? Did you manually blast some of the unmapped reads, maybe a contamination in the TT2 stock? ...
written 3 days ago by ATPoint720
0
votes
1
answer
144
views
1
answers
Comment: C: Sorting samtools output by flag or grepping its tags
... I think the 256 flag only means that it is not a primary alignment. This can then be a chimeric one that has been tagged as 256 due to the -M option, but also a multimapping read. If reads multimap, then one is randomly chosen to be primary, all others get flagged as secondary. That means SA:Z is on ...
written 4 days ago by ATPoint720
0
votes
3
answers
424
views
3
answers
Comment: C: weird insert size post trimming
... Please give the full command for cutadapt. I saw this kind of odd shape before, but it turned out that adapters were improperly trimmed. What are the Nextera sequences that you trimmed for? ...
written 4 days ago by ATPoint720

Latest awards to ATPoint

Centurion 8 days ago, created 100 posts.
Commentator 13 days ago, created a comment with at least 3 up-votes. For C: To screen for a good aligner
Scholar 5 weeks ago, created an answer that has been accepted. For A: Bedtools sortBed | uniq and bash sort | uniq returns different number of lines
Good Answer 8 months ago, created an answer that was upvoted at least 5 times. For A: Bedtools sortBed | uniq and bash sort | uniq returns different number of lines
Supporter 8 months ago, voted at least 25 times.
Student 9 months ago, asked a question with at least 3 up-votes. For Deeptools: computeMatrix - Traceback
Teacher 11 months ago, created an answer with at least 3 up-votes. For A: Bedtools sortBed | uniq and bash sort | uniq returns different number of lines
Scholar 11 months ago, created an answer that has been accepted. For A: Bedtools sortBed | uniq and bash sort | uniq returns different number of lines
Good Answer 14 months ago, created an answer that was upvoted at least 5 times. For A: Bedtools sortBed | uniq and bash sort | uniq returns different number of lines
Scholar 14 months ago, created an answer that has been accepted. For A: Bedtools sortBed | uniq and bash sort | uniq returns different number of lines
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: Bedtools sortBed | uniq and bash sort | uniq returns different number of lines

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 673 users visited in the last hour