User: Chadi Saad

gravatar for Chadi Saad
Chadi Saad70
Reputation:
70
Status:
Trusted
Location:
France
Last seen:
1 week, 1 day ago
Joined:
4 years ago
Email:
c*********@hotmail.com

Posts by Chadi Saad

<prev • 34 results • page 1 of 4 • next >
0
votes
2
answers
71
views
2
answers
Comment: C: VEP cache trancript versions
... we can't have something like GCF_000001405.39_**GRCh37**_genomic.gff (the same GCF used for GRCH38 GCF_000001405.39_GRCh38.p13_genomic.gff) ? why using GCF_000001405.25 for GRCh37 ...
written 11 days ago by Chadi Saad70
0
votes
2
answers
71
views
2
answers
VEP cache trancript versions
... I have a same variant obtained once on GRCH37 and once on GRCH38 I want to annotate it with VEP to obtain the HGVS annotation. So I use VEP (v100) to annotate both variants. On GrcH37, the variant is annotated with NM_001160184.1, while for GRCH38, this variant is annotated with NM_001160184.2. It ...
annotation ngs dna-seq vep sequencing written 11 days ago by Chadi Saad70 • updated 8 days ago by Michal @Ensembl20
0
votes
1
answer
339
views
1
answers
Comment: C: BWA not reporting all similar alignments
... i will try Bowtie2. Thanks alot ! ...
written 8 months ago by Chadi Saad70
0
votes
1
answer
339
views
1
answers
Comment: C: BWA not reporting all similar alignments
... So their are is no way to get multiple Proper Pairs (even with -a) ? BWA will take a random choice ? My second question: since the MAPQ 0 will impact the variant calling process, can I replace the MAPQ0 by the true MAPQ ? ...
written 8 months ago by Chadi Saad70
0
votes
1
answer
339
views
1
answers
Comment: C: BWA not reporting all similar alignments
... So to resume, BWA gave a MAPQ 0 to reads because they map to multiple regions (without taking into account the pair information). But In the BAM file, I found only one occurrence per read-pair because the others combinations are not Proper Pairs ? (so **-a** would be useful only in case of multiple ...
written 8 months ago by Chadi Saad70
0
votes
1
answer
339
views
1
answers
Comment: C: BWA not reporting all similar alignments
... Thanks for this explanation ! Then why the read have MAPQ 0 when aligning the whole FQ, while in the BAM file I have an uniq alignement ? ...
written 8 months ago by Chadi Saad70
0
votes
1
answer
339
views
1
answers
Comment: C: BWA not reporting all similar alignments
... when aligning only one read: M01878:748:000000000-BVLWH:1:2102:10051:6653 81 chr7 6013079 0 151M = 6013017 -213 CTTCCATGGGGACAGTTCCAGGGGTGGTCCATCTCCCCCCTGTGGGTGATCAGTTTCTTCATCTCGCTTGTGTTAAGAGCAGTCCCAATCATCACCTGAGTGTGAGACACAATGGTTCAACGTTTTAGTAGTTTTTTGACGTCAGAATGGC GG ...
written 8 months ago by Chadi Saad70 • updated 8 months ago by h.mon30k
0
votes
1
answer
339
views
1
answers
Comment: C: BWA not reporting all similar alignments
... bwa mem -aM -t 8 -v 3 -R '@RG\tID:group1\tSM:SAMPLE\tPL:Illumina\tLB:Panel\tPU:TEST' ucsc.hg19.fasta test_R1.trimmed.fq.gz test_R2.trimmed.fq.gz > test.sam ...
written 8 months ago by Chadi Saad70
3
votes
1
answer
339
views
1
answer
BWA not reporting all similar alignments
... I'm trying to align reads that belong to high similarity regions (pseudogenes) I'm aligning reads with BWA (last version) using tha **-a** option. When observing the BAM file, I notice that the reads are aligned with MAPQ0. Which is normal. The problem is, every read is present once in the BAM fi ...
alignment next-gen bwa bam written 8 months ago by Chadi Saad70
0
votes
1
answer
243
views
1
answer
Question about deduplication with UMI-tools
... Hello, I deduplicated a BAM file using umitools. Before i had : 98186207 after deduplication, I obtain : 58930293 so the ratio is before/after = 1.6 When I calculate the coverage by BED feature before and after dedup, I obtain a ratio of 6 ! I don't understand this difference betwen the cover ...
umi deduplication sequencing written 11 months ago by Chadi Saad70 • updated 11 months ago by i.sudbery8.2k

Latest awards to Chadi Saad

Popular Question 8 months ago, created a question with more than 1,000 views. For Count mismatchs/Indel number per position in BAM file ?
Popular Question 8 months ago, created a question with more than 1,000 views. For How can I right align InDels ?
Popular Question 19 months ago, created a question with more than 1,000 views. For DNA sequences degeneration
Popular Question 2.7 years ago, created a question with more than 1,000 views. For Extract parts of reads from BAM file that overlap a specific region of genome
Teacher 2.7 years ago, created an answer with at least 3 up-votes. For A: BAM/SAM to FASTA conversion
Scholar 3.0 years ago, created an answer that has been accepted. For A: BAM/SAM to FASTA conversion

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 950 users visited in the last hour