User: beausoleilmo

gravatar for beausoleilmo
beausoleilmo150
Reputation:
150
Status:
Trusted
Location:
McGill University
Website:
http://marcolivierbeau...
Last seen:
1 month, 3 weeks ago
Joined:
1 year, 5 months ago
Email:
b***********@gmail.com

I'm a biologist using statistics and bioinformatics.

Having multiple interest in the world, I want to share what I learn with my entourage. If you have any questions or ideas to share with me, I’ll be glad to hear about it.

glimpse(Interests) :

Biology Ecology Scientific popularization Education Art Music Poetry Philosophy Programmation Politics Your ideas

Posts by beausoleilmo

<prev • 83 results • page 1 of 9 • next >
0
votes
0
answers
270
views
0
answers
How to process degenerate base region (DBRs) in a ddRAD sequencing protocol (remove PCR duplicates)?
... In our lab, we are using ddRAD sequencing with DBR to deal with PCR duplicates. We basically add a DBR, in the Read2 paired end. Here is an example, (the DBR is square brackets): 5'-...N...NTTA[CCIIINNNNN]AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGT...-3' 3'-...N...NAAT[GGMMHNNN ...
bioinformatics next-gen ddrad stacks dbr written 3 months ago by beausoleilmo150 • updated 3 months ago by Biostar ♦♦ 20
7
votes
1
answer
280
views
1
answer
Why is there a star in some primer sequences (library preparation)
... In the [Adapterama paper][1], they are talking about a way to tag individuals within a library preparation for sequencing. At some point, they explain their primer and show this: ` iTru5_01_A: 5';AATGATACGGCGACCACCGAGATCTACAC tag;ACCGACAA 3';ACACTCTTTCCCTA*C` What is the star for in this ...
sequencing library dna written 5 months ago by beausoleilmo150 • updated 5 months ago by WouterDeCoster24k
0
votes
1
answer
294
views
1
answers
Comment: C: What is the difference between a small-insert library, large-insert library and
... So generally, it's just the sequence that is going to be read by a sequencer... it's a fragment of genomic DNA obtained by various methods (such as shearing), and that is keep to be analyzed (such as size selection, biotinylation, etc.). ...
written 6 months ago by beausoleilmo150
3
votes
1
answer
294
views
1
answer
What is the difference between a small-insert library, large-insert library and the reads themselves?
... I'm interested in using a sequence capture method and I was asked about the length of the inserts. I'm wondering what that means. Is it the length of the fragments after shearing? Is it what is going to be read by the sequencer? From my understanding, it's just the size of the fragments that you ...
sequencing written 6 months ago by beausoleilmo150 • updated 6 months ago by Brian Bushnell15k
0
votes
1
answer
223
views
1
answers
Comment: C: What are modules and reactions in NGS?
... Reactions = sample size Module = ? nb Probes = # of sequences or # of sequences / 2 (because you would capture a sequence on both sides)? ...
written 6 months ago by beausoleilmo150
0
votes
1
answer
223
views
1
answer
What are modules and reactions in NGS?
... I'm reading on MYcroarray's website that their kit are built with modules and a certain number of reactions. http://www.mycroarray.com/mybaits/mybaits-custom.html What are the meaning of module and reactions? ...
ngs sequencing written 6 months ago by beausoleilmo150
0
votes
1
answer
287
views
1
answers
Comment: C: Is RADseq the same thing as Shotgun sequencing?
... I've looked here: https://en.wikipedia.org/wiki/Shotgun_sequencing#Next-generation_sequencing. They are saying: "Next-generation sequencing The classical shotgun sequencing was based on the Sanger sequencing method: this was the most advanced technique for sequencing genomes from about 1995–2005. ...
written 8 months ago by beausoleilmo150
3
votes
1
answer
287
views
1
answer
Is RADseq the same thing as Shotgun sequencing?
... I was wondering if Shotgun sequencing was the same thing as RADseq as two methods of Next Generation sequencing. Are they also called Genotyping By Sequencing? ...
radseq shotgun sequencing written 8 months ago by beausoleilmo150 • updated 8 months ago by h.mon10k
1
vote
1
answer
624
views
1
answers
Answer: A: VCFtools --minDP flags not working
... Basically, I think that it's working now. It's just that VCFtools will change the genotype to an unknown state (in other words, look at the genotype field (GT) and see if there is a change before and after the filtering option. This should change).  I thought that the filter would "delete" some lin ...
written 10 months ago by beausoleilmo150
1
vote
1
answer
531
views
1
answers
Comment: C: Converting PLINK to EIGENSTRAT error using convertf (no valid snps)
... Finally it's working! ![enter image description here][1]. In the article you shared, it says: > Principal Components Analysis (PCA) is a tool that has been used to > infer population structure in genetic data for several decades, long > before the GWAS era17–20. It should be noted that ...
written 11 months ago by beausoleilmo150

Latest awards to beausoleilmo

Student 12 weeks ago, asked a question with at least 3 up-votes. For Why is FastQC not working after using Trim galore?
Popular Question 3 months ago, created a question with more than 1,000 views. For Why is FastQC not working after using Trim galore?
Student 5 months ago, asked a question with at least 3 up-votes. For Why is FastQC not working after using Trim galore?
Popular Question 6 months ago, created a question with more than 1,000 views. For Why is FastQC not working after using Trim galore?
Voter 11 months ago, voted more than 100 times.
Autobiographer 14 months ago, has more than 80 characters in the information field of the user's profile.
Supporter 14 months ago, voted at least 25 times.
Scholar 17 months ago, created an answer that has been accepted. For A: Why is FastQC not working after using Trim galore?
Student 17 months ago, asked a question with at least 3 up-votes. For Why is FastQC not working after using Trim galore?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1575 users visited in the last hour