User: beausoleilmo

gravatar for beausoleilmo
beausoleilmo190
Reputation:
190
Status:
Trusted
Location:
McGill University
Website:
http://marcolivierbeau...
Last seen:
1 month, 1 week ago
Joined:
1 year, 10 months ago
Email:
b***********@gmail.com

I'm a biologist using statistics and bioinformatics.

Having multiple interest in the world, I want to share what I learn with my entourage. If you have any questions or ideas to share with me, I’ll be glad to hear about it.

glimpse(Interests) :

Biology Ecology Scientific popularization Education Art Music Poetry Philosophy Programmation Politics Your ideas

Posts by beausoleilmo

<prev • 91 results • page 1 of 10 • next >
0
votes
1
answer
160
views
1
answers
Comment: C: Is whole genome pool-sequencing a reduced representation sequencing technique?
... For example, in RADseq, there is a size selection step so that there is "loss" of sequences that will never be sequenced (too large or too small). From my understanding, if you use illumina sequencing when the genome will be randomly sheared, it's going to be only parts of the genome that will be ...
written 7 weeks ago by beausoleilmo190
0
votes
1
answer
160
views
1
answers
Comment: C: Is whole genome pool-sequencing a reduced representation sequencing technique?
... What I'm usually seen is a 50X coverage for pool-seq on your reads. But since you don't size select, you just read different fragment length. Thus, you are not *sequencing* the whole genome and are therefor doing a reduced representation sequencing technique. I that correct? ...
written 7 weeks ago by beausoleilmo190
5
votes
1
answer
160
views
1
answer
Is whole genome pool-sequencing a reduced representation sequencing technique?
... I was reading a paper and it seems that they compare whole genome pool-sequencing with other technique saying that the the cost of reduced representation sequencing technique by reducing the amount of DNA to be sequenced. > In contrast to the whole-genome approach of Pool-seq, the cost savings ...
dna sequencing whole genome written 7 weeks ago by beausoleilmo190 • updated 7 weeks ago by h.mon15k
0
votes
1
answer
155
views
1
answers
Comment: C: Difference between Allele frequency spectrum and Joint allele frequency spectrum
... Cool! That's great! But if I read the axis on the graph, it's from 0 to 20 which makes 21 comparisons. > we projected the data down to 20 sampled chromosomes per population Where is the 21th comparison coming from? Also, is JAFS only on chromosomes or it can be on SNPs? In addition if you ha ...
written 7 weeks ago by beausoleilmo190
8
votes
1
answer
155
views
5 follow
1
answer
Difference between Allele frequency spectrum and Joint allele frequency spectrum
... From what I understood, [allele frequency spectrum][1] is everything that concerns the frequency of all of the alleles studied in a population. It can be estimated with Tajima's D, theta, etc. But how is it different from the *joint* allele frequency spectrum? [1]: https://en.wikipedia.org/wi ...
population structure allele written 7 weeks ago by beausoleilmo190 • updated 7 weeks ago by Alice230
0
votes
0
answers
128
views
0
answers
Is there a way to construct a pedigree using RADseq data?
... I tried to find a paper showing how to do this, but I found nothing about ˙øw to create a genetic pedigree using neutral markers. Is there a way to construct a pedigree using RAD data? Most of the information I found is talking about *adding* a PED file for analysis, but not how to generate a pedi ...
pedigree rad sequencing written 11 weeks ago by beausoleilmo190
0
votes
1
answer
644
views
1
answers
Comment: C: What is population branch statistic (PBS)?
... Cool! They actually give a good description. Do you know why they say that it's more powerful do detect recent selection sweeps? > It should have power, for example to detect incomplete selective > sweeps, a type of selection that is highly relevant here and which > most other statistics b ...
written 4 months ago by beausoleilmo190
1
vote
1
answer
644
views
1
answer
What is population branch statistic (PBS)?
... In an article about Tibetan adaptation, they talk about a population branch statistic. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3711608/ > By comparing the three pairwise FST values between these three > samples, we can estimate the frequency change that occurred in the > Tibetan popu ...
population structure natural selection fst written 4 months ago by beausoleilmo190 • updated 4 months ago by GabrielMontenegro400
0
votes
0
answers
419
views
0
answers
How to process degenerate base region (DBRs) in a ddRAD sequencing protocol (remove PCR duplicates)?
... In our lab, we are using ddRAD sequencing with DBR to deal with PCR duplicates. We basically add a DBR, in the Read2 paired end. Here is an example, (the DBR is square brackets): 5'-...N...NTTA[CCIIINNNNN]AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGT...-3' 3'-...N...NAAT[GGMMHNNN ...
bioinformatics next-gen ddrad stacks dbr written 9 months ago by beausoleilmo190 • updated 8 months ago by Biostar ♦♦ 20
7
votes
1
answer
414
views
1
answer
Why is there a star in some primer sequences (library preparation)
... In the [Adapterama paper][1], they are talking about a way to tag individuals within a library preparation for sequencing. At some point, they explain their primer and show this: ` iTru5_01_A: 5';AATGATACGGCGACCACCGAGATCTACAC tag;ACCGACAA 3';ACACTCTTTCCCTA*C` What is the star for in this ...
sequencing library dna written 10 months ago by beausoleilmo190 • updated 10 months ago by WouterDeCoster29k

Latest awards to beausoleilmo

Student 7 weeks ago, asked a question with at least 3 up-votes. For Why is FastQC not working after using Trim galore?
Popular Question 11 weeks ago, created a question with more than 1,000 views. For Why is FastQC not working after using Trim galore?
Student 7 months ago, asked a question with at least 3 up-votes. For Why is FastQC not working after using Trim galore?
Student 8 months ago, asked a question with at least 3 up-votes. For Why is FastQC not working after using Trim galore?
Popular Question 8 months ago, created a question with more than 1,000 views. For Why is FastQC not working after using Trim galore?
Student 10 months ago, asked a question with at least 3 up-votes. For Why is FastQC not working after using Trim galore?
Popular Question 11 months ago, created a question with more than 1,000 views. For Why is FastQC not working after using Trim galore?
Voter 16 months ago, voted more than 100 times.
Autobiographer 19 months ago, has more than 80 characters in the information field of the user's profile.
Supporter 19 months ago, voted at least 25 times.
Scholar 22 months ago, created an answer that has been accepted. For A: Why is FastQC not working after using Trim galore?
Student 22 months ago, asked a question with at least 3 up-votes. For Why is FastQC not working after using Trim galore?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1504 users visited in the last hour