User: rbronste

gravatar for rbronste
rbronste160
Reputation:
160
Status:
Trusted
Location:
Last seen:
15 hours ago
Joined:
1 year, 4 months ago
Email:
r************@gmail.com

Posts by rbronste

<prev • 167 results • page 1 of 17 • next >
1
vote
1
answer
67
views
1
answer
Fimo output for classes of TFs from specific database
... Currently if getting a fimo database for specific TFs can do the following: fimo -max-stored-scores 10000000 --thresh 1e-6 -oc /path/to/output/directory -motif /path/to/motif/file \ /path/to/HOCOMOCOv11_HUMAN_mono_meme_format.meme /path/to/whole_genome.fa Is there a good way to do this f ...
fimo meme chip-seq written 8 days ago by rbronste160 • updated 8 days ago by Alex Reynolds23k
0
votes
0
answers
134
views
0
answers
Comment: C: blastn errors following building of database
... Actually when I pull one specific sequence out of the -db input and run a blast on that against gapdh it works however when its many added sequences in the -db input against the -query it gives me this error. ...
written 4 weeks ago by rbronste160
0
votes
0
answers
134
views
0
answers
Comment: C: blastn errors following building of database
... >flattened_line_0 GGGGGTTTTATAATTGTTGCTTTGACTCTGGCCCTGTGCAGCTCCTCCTCTGCTGCCCCGGTGGAGTCCTTTTACCCTCCAAGTTCTGCTGGAGCAGGCCCAGCAAGCCTCGCTCTGGTGGTTTTGGTCCCCTCTGGAAGAAGGGGGTGGGAGGGGCAGGCTGGTGGCTGGAGGAGAAAAGGGATGCGGGTGTGCTAGGGAGCAGGTGATGCAGAGATGGTGAAGTGGCATTGGGAGATGGAGTGTTTAAATGTTAAGGGGTGGGTAGAAA ...
written 4 weeks ago by rbronste160
0
votes
0
answers
134
views
0
answers
Comment: C: blastn errors following building of database
... Building a new DB, current time: 04/19/2018 16:29:25 New DB name: a.lines.fasta New DB title: a.lines Sequence type: Nucleotide Keep Linkouts: T Keep MBits: T Maximum file size: 1000000000B Adding sequences from FASTA; added 947804 sequences in 86.6696 seconds. ...
written 4 weeks ago by rbronste160
0
votes
0
answers
134
views
0
answers
Comment: C: blastn errors following building of database
... I was actually just using the blast that was installed as a module on our computing cluster but yes it is quite aged. I guess I can install my own copy. ...
written 4 weeks ago by rbronste160
0
votes
0
answers
134
views
0
answers
Comment: C: blastn errors following building of database
... Yes one did have spaces, got rid of those however the second error still persists. ...
written 4 weeks ago by rbronste160
5
votes
0
answers
134
views
0
answers
blastn errors following building of database
... Wondering why I am getting following error, building the database as follows: makeblastdb -in a.lines.fasta -input_type fasta -title a.lines -parse_seqids -dbtype nucl -out a.lines.fasta After this running the following command: blastn -db a.lines.fasta -query gapdh_mus.fa Error: Er ...
makeblastdb blast blastn written 4 weeks ago by rbronste160 • updated 15 days ago by Biostar ♦♦ 20
3
votes
2
answers
135
views
2
answers
Extracting the exact motif location from FIMO
... So I am using FIMO on some small datasets to look for motifs of interest and it works quite well to scan a PWM against some fasta file I chose, however the result basically outputs something like the following: MA0041.1 Foxd3 chr1:146119062-146119793 + 24 35 2.03e-07 0.0191 GATTGTTTGTTT MA0 ...
fimo meme motif chip-seq written 5 weeks ago by rbronste160 • updated 5 weeks ago by h.mon14k
0
votes
1
answer
298
views
1
answers
Comment: C: FIMO output to bed
... Your command just pulls out the factor name instead of the interval, seems like the current format for FIMO output is a little different - can you suggest on how to adjust? Thanks!: # motif_id motif_alt_id sequence_name start stop strand score p-value q-value matched_sequence MA0032.2 FOXC ...
written 5 weeks ago by rbronste160
0
votes
1
answer
164
views
1
answers
Comment: C: Adjusting for uneven Nextseq loading
... So you would just subsample at different % until it hits around the size of the other BAM files or is there another downstream metric? ...
written 8 weeks ago by rbronste160

Latest awards to rbronste

Voter 4 weeks ago, voted more than 100 times.
Popular Question 8 weeks ago, created a question with more than 1,000 views. For Trouble installing R package Cairo
Centurion 9 months ago, created 100 posts.
Rising Star 12 months ago, created 50 posts within first three months of joining.
Supporter 12 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1521 users visited in the last hour