User: Bastien Hervé

gravatar for Bastien Hervé
Bastien Hervé2.2k
Reputation:
2,210
Status:
Trusted
Location:
Limoges, CBRS, France
Last seen:
2 minutes ago
Joined:
1 year, 8 months ago
Email:
b****************@orange.fr

Posts by Bastien Hervé

<prev • 467 results • page 1 of 47 • next >
0
votes
1
answer
97
views
1
answers
Comment: C: Samtools view behaviour with skipped region from the reference (N in Cigar)
... I don't want to take up any of your time, if you please I need an advise here I will implement this solution in python using this [pseudocode][1] But I disagree with the Soft Clip/Hard Clip event : - Case1 ( M/X/=) : - start at the specified mapping position, set counter to 1 - Add 1 t ...
written 1 hour ago by Bastien Hervé2.2k
0
votes
1
answer
97
views
1
answers
Comment: C: Samtools view behaviour with skipped region from the reference (N in Cigar)
... Thanks Pierre for this solution and I bet this one is working very well, but I don't want to mess with Java in my python script. ...
written 1 hour ago by Bastien Hervé2.2k
0
votes
1
answer
97
views
1
answers
Comment: C: Samtools view behaviour with skipped region from the reference (N in Cigar)
... My reads are RNA, this read map on the reference from 113260099 to 113260237(113260099+138), then huge gap (169544N), then map from 113429781(113260099+138+169544) to 113429794(113260099+138+169544+13). The logic is that this read map from 113260099 to 113260237 and from 113429781 to 113429794 My ...
written 16 hours ago by Bastien Hervé2.2k
3
votes
1
answer
97
views
1
answer
Samtools view behaviour with skipped region from the reference (N in Cigar)
... I'm trying to use `samtools view` to get reads falling in a given area samtools view in.bam 'chr12:113428514-113428567' | grep "NB500938:125:HY3KMBGX3:4:21501:7767:16841" NB500938:125:HY3KMBGX3:4:21501:7767:16841 99 chr12 113428559 255 151M = 113428600 169 CATAGTAATCACAATAGTGGATTTTTCCTCTATA ...
samtools written 17 hours ago by Bastien Hervé2.2k • updated 16 hours ago by Pierre Lindenbaum113k
1
vote
0
answers
80
views
0
answers
Comment: C: Removing overlaps in GRange function
... You can get all the unique patient id, then : - Loop over this list - For each loop take the patient id and subset your GRanges using the patient id (you'll get a sub Granges with the information of the patient with this id) - Do whatever you want with the sub GRanges ...
written 17 hours ago by Bastien Hervé2.2k
1
vote
0
answers
97
views
0
answers
Comment: C: Python Script to Calculate Total Number of genes
... Sounds like a school project, could you show what you have tried to get a starting point to work on ? ...
written 22 hours ago by Bastien Hervé2.2k
0
votes
3
answers
305
views
3
answers
Comment: C: Which human reference genome should I use?
... For counting I see no problem to delete the ALT_Loci and Patch sequences For variant calling : > Reads will get a very low mapping quality as they can map to the primary assembly and the ALT_Loci. Saying this you are unable to do variant calling for this regions, as reads that can map to multip ...
written 1 day ago by Bastien Hervé2.2k
0
votes
3
answers
305
views
3
answers
Comment: C: Which human reference genome should I use?
... Thanks for the detailed answer ! As I can understand masking PAR region of Y chromosome for variant calling does not lead to false detection. For counting, using the fact that these regions are similar, if you do not mask PAR region on Y you will have bad alignment on these regions (multi mapping). ...
written 1 day ago by Bastien Hervé2.2k
0
votes
0
answers
80
views
0
answers
Comment: A: Removing Overlaps in GRange Function
... For each patient you can subset the Granges using `Participant` column. Then you have a subGRanges with only the data of your patient that you can work with. ...
written 1 day ago by Bastien Hervé2.2k
0
votes
1
answer
116
views
1
answers
Comment: C: how can i use python in multiple sequence alignments?
... What is your error ? Please do your import at the begining of your script `from Bio.Align.Application.import mafftcommandline` ...
written 1 day ago by Bastien Hervé2.2k

Latest awards to Bastien Hervé

Commentator 6 days ago, created a comment with at least 3 up-votes. For C: Need Help Writing Biopython to CSV
Scholar 8 days ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Voter 9 days ago, voted more than 100 times.
Scholar 15 days ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Teacher 6 weeks ago, created an answer with at least 3 up-votes. For A: fastq parsing inefficiencies with python
Popular Question 7 weeks ago, created a question with more than 1,000 views. For Fastest way to subset dataframe in python
Teacher 8 weeks ago, created an answer with at least 3 up-votes. For A: fastq parsing inefficiencies with python
Scholar 8 weeks ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Scholar 3 months ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: fastq parsing inefficiencies with python
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: fastq parsing inefficiencies with python
Scholar 3 months ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Scholar 3 months ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Scholar 3 months ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: fastq parsing inefficiencies with python
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: fastq parsing inefficiencies with python
Scholar 4 months ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Scholar 4 months ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Appreciated 4 months ago, created a post with more than 5 votes. For C: Python or R
Commentator 4 months ago, created a comment with at least 3 up-votes. For C: Need Help Writing Biopython to CSV
Guru 5 months ago, received more than 100 upvotes.
Scholar 5 months ago, created an answer that has been accepted. For A: fastq parsing inefficiencies with python
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: fastq parsing inefficiencies with python
Commentator 5 months ago, created a comment with at least 3 up-votes. For C: Need Help Writing Biopython to CSV
Commentator 5 months ago, created a comment with at least 3 up-votes. For C: Need Help Writing Biopython to CSV

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1916 users visited in the last hour