User: barrypraveen

gravatar for barrypraveen
Reputation:
0
Status:
New User
Last seen:
2 weeks, 5 days ago
Joined:
2 months, 3 weeks ago
Email:
b***********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by barrypraveen

<prev • 44 results • page 1 of 5 • next >
1
vote
0
answers
82
views
0
answers
What is difference between default mode and with parameter mode in HTSeq?
... Hi, I am working with RNA-Sequencing data analysis. I was confused with my outputs. I have a condition for my analysis. First, i did HTSeq without parameters again I did HTSeq with additional parameters ( -s -t -m ). But i found the huge difference between these two outputs like two-fold increased ...
htseq ngs rna-seq written 5 weeks ago by barrypraveen0
0
votes
1
answer
178
views
1
answers
Comment: C: How to identify adapters in FASTQ file?
... Okay. But in some fastqc files i found like that. ...
written 6 weeks ago by barrypraveen0
0
votes
0
answers
97
views
0
answers
Comment: C: Data replicating error?
... Thanks for your suggestion. ...
written 6 weeks ago by barrypraveen0
0
votes
0
answers
97
views
0
answers
Comment: C: Data replicating error?
... Thanks for your answer. yes some small variation could be applicable. But compare to my output they got two fold high for all reads. Is it possible? So what is the problem? and another question also. If any additional parameter can make this kind of variation. ...
written 6 weeks ago by barrypraveen0
0
votes
0
answers
97
views
0
answers
Data replicating error?
... I am working with RNA Seq data analysis. so I am interested in replicating your data (Transcriptional comparison of the filamentous fungus Neurospora crassa growing on three major monosaccharides D-glucose, D-xylose and L-arabinose) (**https://biotechnologyforbiofuels.biomedcentral.com/articles/10.1 ...
software error ngs rna-seq written 6 weeks ago by barrypraveen0
0
votes
1
answer
178
views
1
answers
Comment: C: How to identify adapters in FASTQ file?
... Thanks for your answer. ...
written 6 weeks ago by barrypraveen0
0
votes
1
answer
178
views
1
answers
Comment: C: How to identify adapters in FASTQ file?
... sorry. I forget to mention. these are the Neurospora crassa samples. ...
written 6 weeks ago by barrypraveen0
0
votes
1
answer
178
views
1
answers
Comment: C: How to identify adapters in FASTQ file?
... Thanks for your reply. I have a question here. CTTCACTTCACAACATCTTCTCAACCTTCCAACTCACCTTCCAAACCAC sequences are part of the N.crassa. not an adapters right. but why these sequences comes under overrepresented sequences. In overrepresented sequences describing contamination and adapters sequences. ...
written 6 weeks ago by barrypraveen0
4
votes
1
answer
178
views
1
answer
How to identify adapters in FASTQ file?
... Dear all, I have seen many answers regarding my doubt. But still, i am not clear. I have some fastq files i did fastqc for quality check. I got overrepresented sequences like this **SequenceCount Percentage Possible Source** CTTCACTTCACAACATCTTCTCAACCTTCCAACTCAC ...
ngs rna-seq fastqc written 6 weeks ago by barrypraveen0 • updated 6 weeks ago by WouterDeCoster16k
0
votes
0
answers
122
views
0
answers
Comment: C: DESeq error of my data?
... Thanks for your reply and valuable suggestion. It works now. ...
written 7 weeks ago by barrypraveen0

Latest awards to barrypraveen

Supporter 8 weeks ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1085 users visited in the last hour