User: Javad

gravatar for Javad
Javad60
Reputation:
60
Status:
Trusted
Location:
Last seen:
1 week, 2 days ago
Joined:
2 years ago
Email:
e*************@gmail.com

Posts by Javad

<prev • 49 results • page 1 of 5 • next >
1
vote
0
answers
67
views
0
answers
How to separate different kinds of RNA in my list of gene
... Dear all, I have a normal RNA seq count table with around 40000 rows. In my data I would like to seperate "protein coding", long non-coding", "pseudo gene", "misc" RNA etc. to analyse each one of them separately. (I have the Ensemble ID corresponding to each row). is there a straight forward way to ...
rna-seq written 12 days ago by Javad60
1
vote
0
answers
79
views
0
answers
How to create a back-end database of gene expression data
... Dear all, I have a question regarding database management. I would be really grateful if somebody here can help me. I have a table with 100,000 columns and 30,000 rows that I would like to store it in a back end database like SQLite or mySQL. The problem is that programs like SQLite have a limitati ...
rna-seq written 4 weeks ago by Javad60
2
votes
1
answer
435
views
1
answer
Differential expression analysis of normalized expression of RNA seq data
... Dear All, I have a normalized expression table of RNA seq data. I normally use DESeq2 but it needs raw count table not normalized data. Which R package I can use to analyse a Normalised table? Best, ...
rna-seq written 8 months ago by Javad60 • updated 8 months ago by Benn6.6k
0
votes
0
answers
291
views
0
answers
Comment: C: How to count different features at the same time with htseq
... Then how the command would look like? ...
written 8 months ago by Javad60
2
votes
0
answers
291
views
0
answers
How to count different features at the same time with htseq
... Dear all, I want to do counting of my data set and I do like to count the number of reads aligned to the gene, UTR and sRNA at the same time. As the --type argument of htseq only accepts one feature at a time, is there a way that I can count these features together. And if this is not possible wi ...
rna-seq written 8 months ago by Javad60
0
votes
4
answers
1.2k
views
4
answers
Comment: C: how to produce plots like this in R
... Thanks a lot. It is a very good suggestion but the problem is that I need something that I have full control on the graph production. I need to factor the data and compare different data sets in a same figure. That is why I asked for a ggplot2 tutorial. ...
written 9 months ago by Javad60
7
votes
4
answers
1.2k
views
8 follow
4
answers
how to produce plots like this in R
... Dear all, I am looking for the R package that I can use to produce this type of graphs: I know ggplot2 has probably this capability but I can not find a proper tutorial to do it. I would be grateful if somebody can introduce a tutorial of how to produce these types of graphs. Thanks ...
rna-seq written 9 months ago by Javad60 • updated 3 months ago by gaelgarcia05190
4
votes
1
answer
782
views
5 follow
1
answer
The best way to produce gene body coverage
... Hello every body, Can anyone suggest an approach to produce gene body coverage. I already used qualimap. I am looking for other suggestions. Best ...
rna-seq written 10 months ago by Javad60 • updated 10 months ago by Antonio R. Franco4.0k
0
votes
0
answers
481
views
0
answers
Comment: C: problem in running cutadapt on multiple cores
... Yes. I have 40 cores. ...
written 11 months ago by Javad60
0
votes
0
answers
481
views
0
answers
Comment: C: problem in running cutadapt on multiple cores
... Hello, Here it is: This one works: cutadapt -u 15 -U 5 -m 20 -g GATGGTTGAGGATGTGTGGAG -G GATGGTTGAGGATGTGTGGAG -g TCCACACATCCTCAACCATC -G CTCCACACATCCTCAACCATC -q 25 -o out_R1.fq.bz2 -p out_R2.fq.bz2 /path/to/file/input_R1.fq.bz2 /path/to/file/input_R2.fq.bz2 and this one doesn't: cuta ...
written 11 months ago by Javad60

Latest awards to Javad

Popular Question 7 weeks ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Popular Question 7 weeks ago, created a question with more than 1,000 views. For How to manipulate a gff or gtf file manually?
Popular Question 11 weeks ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Popular Question 3 months ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Great Question 5 months ago, created a question with more than 5,000 views. For looking for an R package for GO term analysis
Popular Question 5 months ago, created a question with more than 1,000 views. For Converting GTF file to UCSC-styled bed file
Popular Question 5 months ago, created a question with more than 1,000 views. For looking for an R package for GO term analysis
Popular Question 5 months ago, created a question with more than 1,000 views. For RNA spike-ins: Their applications and bioinformatics methods for the analysis
Popular Question 8 months ago, created a question with more than 1,000 views. For htseq-count output file
Popular Question 8 months ago, created a question with more than 1,000 views. For htseq-count output file
Popular Question 10 months ago, created a question with more than 1,000 views. For looking for an R package for GO term analysis
Popular Question 12 months ago, created a question with more than 1,000 views. For looking for an R package for GO term analysis
Supporter 15 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1586 users visited in the last hour