User: Javad

gravatar for Javad
Javad0
Reputation:
0
Status:
New User
Last seen:
1 day ago
Joined:
1 year, 2 months ago
Email:
e*************@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by Javad

<prev • 41 results • page 1 of 5 • next >
0
votes
0
answers
111
views
0
answers
Comment: C: problem in running cutadapt on multiple cores
... Yes. I have 40 cores. ...
written 20 days ago by Javad0
0
votes
0
answers
111
views
0
answers
Comment: C: problem in running cutadapt on multiple cores
... Hello, Here it is: This one works: cutadapt -u 15 -U 5 -m 20 -g GATGGTTGAGGATGTGTGGAG -G GATGGTTGAGGATGTGTGGAG -g TCCACACATCCTCAACCATC -G CTCCACACATCCTCAACCATC -q 25 -o out_R1.fq.bz2 -p out_R2.fq.bz2 /path/to/file/input_R1.fq.bz2 /path/to/file/input_R2.fq.bz2 and this one doesn't: cuta ...
written 20 days ago by Javad0
1
vote
0
answers
111
views
0
answers
problem in running cutadapt on multiple cores
... Dear all, I am trying to use cutadadpt for trimming adapters. It works perfectly when I run it on single core but when I try to use it on multiple cores I get the following error. ERROR: Traceback (most recent call last): File "/home/user/.local/lib/python3.6/site-packages/cutadapt/pipel ...
rna-seq written 20 days ago by Javad0
0
votes
0
answers
71
views
0
answers
How to remove primers from a sequencing run with cutadapt
... Dear all, I would like to use cutadapt to trim the primers from my sequencing run. I was just wondering when I give the sequence of my primer to cutadapt, do I also have to give the complementary sequence as well? for example let's say my primer is: AATC Then is this command "`cutadapt -g AATC in ...
rna-seq written 22 days ago by Javad0
1
vote
1
answer
119
views
1
answer
SNPs identification in Human
... Dear all, I would like to ask you a question regarding identification of SNPs in individuals. I have the exome sequence of around 20 individuals (Human) and I would like to identify the SNPs in the exome of theses persons. I have never worked with SNPs before so I would be grateful if somebody c ...
rna-seq written 7 weeks ago by Javad0 • updated 7 weeks ago by genomax49k
2
votes
2
answers
100
views
2
answers
differences in different versions of genomic assemblies
... Hello everybody, Could you please explain what is the difference between different versions of genomics assemblies. I am particularly interested to know when a new version of genomic assemblies is published (for example GRCh37 vs GRCh38), does the coordinates of different genomic features change or ...
rna-seq written 8 weeks ago by Javad0 • updated 8 weeks ago by genomax49k
0
votes
3
answers
313
views
3
answers
Comment: C: SNPs in 1000 genome project
... I don't think it would be just a single command. because the coordinates of exons are not included in the vcf file. Am I missing some thing? Could you please give me some hints to go through it? Thanks ...
written 9 weeks ago by Javad0
0
votes
3
answers
313
views
3
answers
Comment: A: SNPs in 1000 genome project
... Yeah, But I didn't want to write scripts. I thought maybe this data is already stored somewhere. Thank you anyway. ...
written 9 weeks ago by Javad0
15
votes
3
answers
313
views
7 follow
3
answers
SNPs in 1000 genome project
... Hello every body, I want to have SNPs of 1000 genome project only for exons. The database of 1000 genome project includes SNPs for the whole genome. Is there an easy way to filter and download data only for exons. I don't want to spend time on writing scripts to filter data. I would be grateful if ...
snp written 9 weeks ago by Javad0 • updated 8 weeks ago by Alex Reynolds24k
0
votes
0
answers
250
views
0
answers
Comment: C: How to run cutadapt in parallel
... I ran this one for example: > parallel -k -j 24 cutadapt -u 15 -o output.fastq input.fastq What can I change to make it right? Thanks a lot... ...
written 4 months ago by Javad0

Latest awards to Javad

Popular Question 8 weeks ago, created a question with more than 1,000 views. For looking for an R package for GO term analysis
Supporter 4 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1962 users visited in the last hour