User: vinayjrao

gravatar for vinayjrao
vinayjrao140
Reputation:
140
Status:
Trusted
Location:
JNCASR, India
Last seen:
2 months, 1 week ago
Joined:
2 years, 3 months ago
Email:
v********@gmail.com

Posts by vinayjrao

<prev • 129 results • page 1 of 13 • next >
3
votes
1
answer
136
views
1
answer
Filtering 2-fold differentially expressed genes
... Hi, I am working with a microarray dataset, which is in the format - > Control      Control2      Treatment      Treatment2 The dataset has been log transformed. I want to know if there a way to filter the data such that I get genes whose fold difference is greater than 2 fold in Treatment as ...
R microarray written 11 weeks ago by vinayjrao140 • updated 11 weeks ago by Nicolas Rosewick8.1k
0
votes
2
answers
161
views
2
answers
Comment: C: Averaging multiple columns
... Thank you for your help. It works perfectly. ...
written 12 weeks ago by vinayjrao140
0
votes
2
answers
161
views
2
answers
Comment: C: Averaging multiple columns
... Thank you for your reply. I am still working on it. Will update once done. ...
written 12 weeks ago by vinayjrao140
4
votes
2
answers
161
views
2
answers
Averaging multiple columns
... Hi, I have a file with five columns, from which I want the mean of the last four columns where the first rows of the first column are the same. For example, my file looks like this - A 1 1 1 1 A 1 3 1 1 A 1 1 2 3 B 5 7 2 4 C 2 1 5 1 C 2 2 3 6 The desired output is - A ...
R shell written 12 weeks ago by vinayjrao140 • updated 12 weeks ago by zx87548.2k
1
vote
1
answer
176
views
1
answer
How to merge 2 dataframes based on common column names?
... Hi, I have two data frames, both containing the columns `GeneName` and `logFC`. Using `intersect()`, I have obtained the common genes between the two. I want to know how to merge my two dataframes based on the common dataframe. Thank you. ...
R written 3 months ago by vinayjrao140 • updated 3 months ago by lakhujanivijay4.4k
0
votes
0
answers
164
views
0
answers
Comment: C: Probe Sequence Missing from Agilent Data
... Thanks Kevin, for the clarification. Although, I would like to know why I should remove these after normalization, and what is the significance of these positive control probes? ...
written 3 months ago by vinayjrao140
0
votes
0
answers
164
views
0
answers
Comment: C: Probe Sequence Missing from Agilent Data
... Dear Kevin, Thank you for your response. I am arranging some of the details below - > ProbeUID     ProbeName     Sequence > 51568     GT_Mm_44k_51_P314501     ACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCA > 1164     (+)E1A_r60_1     `Sequence Column is Empty` And you sai ...
written 3 months ago by vinayjrao140
0
votes
1
answer
2.4k
views
1
answers
Comment: C: Single-color Agilent array analyzing in R
... I want to be able to see the contents of each file imported using `readTargets`. Is that possible? ...
written 3 months ago by vinayjrao140
0
votes
0
answers
129
views
0
answers
log2FC Difference Across Control Samples
... Hi, I am analyzing raw microarray data obtained using the Agilent system. When I was looking at the pre-analyzed results of the same data, I found that the two control samples were additive inverses of each other (-0.42, 0.42), thereby canceling each other to give a median log2FC of 0, but this tre ...
agilent microarray written 3 months ago by vinayjrao140
2
votes
0
answers
164
views
0
answers
Probe Sequence Missing from Agilent Data
... Hi, I am analyzing raw microarray data obtained using the Agilent system. While looking at the results table, I found that a lot of the probes do not have a probe sequence. Could someone please guide me through these probes? Are these used only by the system, and do not mean anything biologically? ...
agilent microarray written 3 months ago by vinayjrao140

Latest awards to vinayjrao

Great Question 11 weeks ago, created a question with more than 5,000 views. For grep a column based on a string
Popular Question 3 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Great Question 4 months ago, created a question with more than 5,000 views. For Setting the first row as column name in R
Popular Question 4 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 6 months ago, created a question with more than 1,000 views. For how to calculate fpkm?
Popular Question 8 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 12 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 12 months ago, created a question with more than 1,000 views. For grep a column based on a string
Popular Question 12 months ago, created a question with more than 1,000 views. For understanding bedtools coverage output
Centurion 14 months ago, created 100 posts.
Popular Question 15 months ago, created a question with more than 1,000 views. For understanding bedtools coverage output
Popular Question 15 months ago, created a question with more than 1,000 views. For Ballgown Error in file(file, "rt") : invalid 'description' argument
Popular Question 16 months ago, created a question with more than 1,000 views. For Setting the first row as column name in R
Supporter 18 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1679 users visited in the last hour