User: vinayjrao

gravatar for vinayjrao
vinayjrao120
Reputation:
120
Status:
Trusted
Location:
JNCASR, India
Last seen:
2 days, 2 hours ago
Joined:
2 years ago
Email:
v********@gmail.com

Posts by vinayjrao

<prev • 124 results • page 1 of 13 • next >
0
votes
0
answers
81
views
0
answers
Comment: C: Probe Sequence Missing from Agilent Data
... Thanks Kevin, for the clarification. Although, I would like to know why I should remove these after normalization, and what is the significance of these positive control probes? ...
written 4 days ago by vinayjrao120
0
votes
0
answers
81
views
0
answers
Comment: C: Probe Sequence Missing from Agilent Data
... Dear Kevin, Thank you for your response. I am arranging some of the details below - > ProbeUID     ProbeName     Sequence > 51568     GT_Mm_44k_51_P314501     ACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCA > 1164     (+)E1A_r60_1     `Sequence Column is Empty` And you sai ...
written 5 days ago by vinayjrao120
0
votes
1
answer
2.0k
views
1
answers
Comment: C: Single-color Agilent array analyzing in R
... I want to be able to see the contents of each file imported using `readTargets`. Is that possible? ...
written 5 days ago by vinayjrao120
0
votes
0
answers
59
views
0
answers
log2FC Difference Across Control Samples
... Hi, I am analyzing raw microarray data obtained using the Agilent system. When I was looking at the pre-analyzed results of the same data, I found that the two control samples were additive inverses of each other (-0.42, 0.42), thereby canceling each other to give a median log2FC of 0, but this tre ...
agilent microarray written 5 days ago by vinayjrao120
2
votes
0
answers
81
views
0
answers
Probe Sequence Missing from Agilent Data
... Hi, I am analyzing raw microarray data obtained using the Agilent system. While looking at the results table, I found that a lot of the probes do not have a probe sequence. Could someone please guide me through these probes? Are these used only by the system, and do not mean anything biologically? ...
agilent microarray written 5 days ago by vinayjrao120
0
votes
3
answers
12k
views
3
answers
Comment: C: Microarray: How To Select One Of Multiple Probes Corresponding To A Gene
... Dear Davy, I understand that it has been a long time since your suggestion, but in my opinion, option 8 might be considered as cherry picking from the data, since you are only interested in ones with the lowest p-value, and that might not implicate the biological scenario, especially when we look i ...
written 5 days ago by vinayjrao120
0
votes
1
answer
2.0k
views
1
answers
Comment: C: Single-color Agilent array analyzing in R
... Hi Leite, When I read the `targets.txt` file, will the individual files be accessible through R? Thanks ...
written 6 days ago by vinayjrao120
1
vote
0
answers
269
views
0
answers
Interpreting GSEA enrichment plots/results
... Hi, To address a particular question, concerning a particular gene, which we hypothesize is involved in reducing DNA damage repair, we decided to analyze RNA-Seq data from TCGA. Upon analysis, we found that the particular gene is overexpressed in breast cancer, but we could not get an enrichment in ...
rna-seq gsea written 3 months ago by vinayjrao120
0
votes
1
answer
260
views
1
answers
Comment: C: Plotting TCGA's HM450 data
... I have just another question. Is it acceptable to correlate expression and methylation pattern by plotting a PCC? If yes, should it be done by adjusting the RSEM counts from 0 to 1, or should it be done with the raw values? ...
written 5 months ago by vinayjrao120
0
votes
1
answer
260
views
1
answers
Comment: C: Plotting TCGA's HM450 data
... Thanks a lot, Kevin. You have been extremely helpful. ...
written 5 months ago by vinayjrao120

Latest awards to vinayjrao

Popular Question 17 days ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Great Question 7 weeks ago, created a question with more than 5,000 views. For Setting the first row as column name in R
Popular Question 7 weeks ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 3 months ago, created a question with more than 1,000 views. For how to calculate fpkm?
Popular Question 5 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 9 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 9 months ago, created a question with more than 1,000 views. For grep a column based on a string
Popular Question 9 months ago, created a question with more than 1,000 views. For understanding bedtools coverage output
Centurion 11 months ago, created 100 posts.
Popular Question 12 months ago, created a question with more than 1,000 views. For understanding bedtools coverage output
Popular Question 12 months ago, created a question with more than 1,000 views. For Ballgown Error in file(file, "rt") : invalid 'description' argument
Popular Question 12 months ago, created a question with more than 1,000 views. For Setting the first row as column name in R
Supporter 15 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 672 users visited in the last hour