User: vinayjrao

gravatar for vinayjrao
vinayjrao170
Reputation:
170
Status:
Trusted
Location:
JNCASR, India
Last seen:
2 days, 21 hours ago
Joined:
2 years, 8 months ago
Email:
v********@gmail.com

Posts by vinayjrao

<prev • 131 results • page 1 of 14 • next >
0
votes
2
answers
81
views
2
answers
Comment: C: Correlation between coverage and variant calling
... Thank you both for the insight. Although, it is still not clear to me whether a decrease in fastq file size will linearly reduce the number of variants? ...
written 3 days ago by vinayjrao170
7
votes
2
answers
81
views
2
answers
Correlation between coverage and variant calling
... Hi, I analyzed a few human Exome-Seq data sets, and I noticed that their fastq files were around 2.5 Gb each. I am analyzing another set, where the fastq files are around 900 Mb. After aligning both with hg38, and following the same pipeline, I noticed upon variant calling (GATK HaplotypeCaller) th ...
exome-seq variant_calling snp written 3 days ago by vinayjrao170 • updated 3 days ago by harish260
3
votes
1
answer
203
views
1
answer
Filtering 2-fold differentially expressed genes
... Hi, I am working with a microarray dataset, which is in the format - > Control      Control2      Treatment      Treatment2 The dataset has been log transformed. I want to know if there a way to filter the data such that I get genes whose fold difference is greater than 2 fold in Treatment as ...
R microarray written 7 months ago by vinayjrao170 • updated 7 months ago by Nicolas Rosewick8.6k
0
votes
2
answers
255
views
2
answers
Comment: C: Averaging multiple columns
... Thank you for your help. It works perfectly. ...
written 8 months ago by vinayjrao170
0
votes
2
answers
255
views
2
answers
Comment: C: Averaging multiple columns
... Thank you for your reply. I am still working on it. Will update once done. ...
written 8 months ago by vinayjrao170
4
votes
2
answers
255
views
2
answers
Averaging multiple columns
... Hi, I have a file with five columns, from which I want the mean of the last four columns where the first rows of the first column are the same. For example, my file looks like this - A 1 1 1 1 A 1 3 1 1 A 1 1 2 3 B 5 7 2 4 C 2 1 5 1 C 2 2 3 6 The desired output is - A ...
R shell written 8 months ago by vinayjrao170 • updated 8 months ago by zx87549.0k
1
vote
1
answer
350
views
1
answer
How to merge 2 dataframes based on common column names?
... Hi, I have two data frames, both containing the columns `GeneName` and `logFC`. Using `intersect()`, I have obtained the common genes between the two. I want to know how to merge my two dataframes based on the common dataframe. Thank you. ...
R written 8 months ago by vinayjrao170 • updated 8 months ago by lakhujanivijay4.7k
0
votes
0
answers
247
views
0
answers
Comment: C: Probe Sequence Missing from Agilent Data
... Thanks Kevin, for the clarification. Although, I would like to know why I should remove these after normalization, and what is the significance of these positive control probes? ...
written 8 months ago by vinayjrao170
0
votes
0
answers
247
views
0
answers
Comment: C: Probe Sequence Missing from Agilent Data
... Dear Kevin, Thank you for your response. I am arranging some of the details below - > ProbeUID     ProbeName     Sequence > 51568     GT_Mm_44k_51_P314501     ACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCA > 1164     (+)E1A_r60_1     `Sequence Column is Empty` And you sai ...
written 8 months ago by vinayjrao170
0
votes
1
answer
3.0k
views
1
answers
Comment: C: Single-color Agilent array analyzing in R
... I want to be able to see the contents of each file imported using `readTargets`. Is that possible? ...
written 8 months ago by vinayjrao170

Latest awards to vinayjrao

Popular Question 4 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 4 months ago, created a question with more than 1,000 views. For Interpreting GSEA enrichment plots/results
Student 4 months ago, asked a question with at least 3 up-votes. For Interpreting GSEA enrichment plots/results
Popular Question 4 months ago, created a question with more than 1,000 views. For No differential gene expression after tuxedo protocol
Popular Question 7 months ago, created a question with more than 1,000 views. For grep a column based on a string
Great Question 8 months ago, created a question with more than 5,000 views. For grep a column based on a string
Popular Question 8 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Great Question 10 months ago, created a question with more than 5,000 views. For Setting the first row as column name in R
Popular Question 10 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 11 months ago, created a question with more than 1,000 views. For how to calculate fpkm?
Popular Question 13 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Popular Question 18 months ago, created a question with more than 1,000 views. For grep a column based on a string
Popular Question 18 months ago, created a question with more than 1,000 views. For understanding bedtools coverage output
Popular Question 18 months ago, created a question with more than 1,000 views. For Formula to calculate FPKM
Centurion 19 months ago, created 100 posts.
Popular Question 20 months ago, created a question with more than 1,000 views. For understanding bedtools coverage output
Popular Question 20 months ago, created a question with more than 1,000 views. For Ballgown Error in file(file, "rt") : invalid 'description' argument
Popular Question 21 months ago, created a question with more than 1,000 views. For Setting the first row as column name in R
Supporter 24 months ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 698 users visited in the last hour