Moderator: Kevin Blighe

gravatar for Kevin Blighe
Kevin Blighe26k
Reputation:
25,610
Status:
Trusted
Location:
USA / Europe / Brazil
Website:
https://github.com/kev...
Last seen:
5 hours ago
Joined:
11 months, 3 weeks ago
Email:
k**********@outlook.com

Irish bioinformatician. Previously worked in USA, Italy, Malta, Brazil, UK, and Ireland.

----------------------------------------------

Developer / Maintainer of Bioconductor packages:

  • EnhancedVolcano (submitted)
  • https://github.com/kevinblighe/CorLevelPlot (dev)

----------------------------------------------

There are mountains in our way... but we climb a step every day...

Nella fantasia, io vedo un mondo giusto; Lì, tutti vivono in pace e in onestà; Io sogno d'anime che sono sempre libere...

Posts by Kevin Blighe

<prev • 3,906 results • page 1 of 391 • next >
0
votes
0
answers
3.4k
views
0
answers
Comment: C: Produce PCA bi-plot for 1000 Genomes Phase III in VCF format
... Oh! You have to use plink v1.9: https://www.cog-genomics.org/plink2 ...
written 5 hours ago by Kevin Blighe26k
0
votes
1
answer
134
views
1
answers
Comment: C: SNPs genomic classification based on VCF annotation
... Please reply to cpad via the `ADD COMMENT` button ...
written 6 hours ago by Kevin Blighe26k
0
votes
1
answer
433
views
1
answers
Comment: C: Merging vcf files (intersection and union)
... Yes, you can proceed ...
written 12 hours ago by Kevin Blighe26k
1
vote
1
answer
167
views
1
answers
Comment: C: bcftools roh: short way to put several samples from a merged VCF in the same col
... I think that you need to do the following (assuming that you have separate VCF files): 1. rename the sample ID in each file to have the same ID (`bcftools reheader`) 2. concatenate all and remove duplicates (essentially a UNION of all variants in all files) (`bcftools concat VCF1.vcf.gz V ...
written 12 hours ago by Kevin Blighe26k
0
votes
0
answers
128
views
0
answers
Comment: C: Annotation of huge number of CNV files
... That command requires a lot of memory. For the TCGA breast cancer data (~1000 samples), it neither runs on my laptop with 16GB RAM. Do you have access to a supercompute cluster? ...
written 14 hours ago by Kevin Blighe26k
0
votes
1
answer
70
views
1
answers
Answer: A: GWAS: how do we know we have the most appropriate model?
... You will likely / hopefully receive a more in depth response on Cross Validated, which is more 'statistics'-aligned than we are. The simplest type of association test just looks at allele tallies in cases versus controls and derives a Chi-square *P* value from this, as I go over step-by-step here: ...
written 15 hours ago by Kevin Blighe26k
0
votes
1
answer
50
views
1
answers
Answer: A: how to get circRNA fasta sequence from CIRI bed
... # BEDTools getfasta You can use BEDTools getFasta: cat test.bed 5 1000000 1000500 9 5000 6000 bedtools getfasta -fi 1000Genomes/human_g1k_v37.fasta -bed test.bed -fo test.fasta cat test.fasta >5:1000000-1000500 GTTTTAACTAAACTAACTCCCCAAAAACTGGACACGTGACTTC ...
written 15 hours ago by Kevin Blighe26k
0
votes
0
answers
128
views
0
answers
Comment: C: Annotation of huge number of CNV files
... Maybe try to increase the adjusted P value threshold from `threshold=0.15` to `threshold=0.2`? What is the output of `head(cnv_obj)` ? ...
written 17 hours ago by Kevin Blighe26k
0
votes
0
answers
230
views
0
answers
Comment: C: Did anyone manage to successfully run HLAScan and get results?
... Do not worry, my friend. Perhaps you can contact the developers of the program: https://omictools.com/hlascan-tool From what I can see, the program result is HLA-A, that is, the program identified that your sample sequence data contained HLA Class A. ...
written 1 day ago by Kevin Blighe26k
2
votes
1
answer
167
views
1
answers
Comment: C: bcftools roh: short way to put several samples from a merged VCF in the same col
... miqrom, you have never definitively explained what you want. Some test input and expected output would be a great help for both Ram and I. We are volunteers and are aiming to help you on our own free time. ...
written 1 day ago by Kevin Blighe26k

Latest awards to Kevin Blighe

Scholar 1 day ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Teacher 2 days ago, created an answer with at least 3 up-votes. For A: Bcftools merge taking too much time and producing large file
Scholar 3 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Teacher 4 days ago, created an answer with at least 3 up-votes. For A: Bcftools merge taking too much time and producing large file
Teacher 4 days ago, created an answer with at least 3 up-votes. For A: DESeq2 Appropriate Settings for Poorly Clustering Samples?
Scholar 5 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Teacher 5 days ago, created an answer with at least 3 up-votes. For A: Bcftools merge taking too much time and producing large file
Teacher 5 days ago, created an answer with at least 3 up-votes. For A: Bcftools merge taking too much time and producing large file
Teacher 5 days ago, created an answer with at least 3 up-votes. For A: Bcftools merge taking too much time and producing large file
Scholar 5 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Teacher 5 days ago, created an answer with at least 3 up-votes. For A: Bcftools merge taking too much time and producing large file
Scholar 5 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Scholar 7 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Scholar 7 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Scholar 8 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Teacher 8 days ago, created an answer with at least 3 up-votes. For A: Bcftools merge taking too much time and producing large file
Popular Question 8 days ago, created a question with more than 1,000 views. For R functions edited for parallel processing
Scholar 16 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Scholar 17 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Scholar 18 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Scholar 20 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Good Answer 20 days ago, created an answer that was upvoted at least 5 times. For A: Volcano plot help code
Teacher 21 days ago, created an answer with at least 3 up-votes. For A: Bcftools merge taking too much time and producing large file
Scholar 21 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19
Scholar 22 days ago, created an answer that has been accepted. For A: Minor Reference Allele Frequency in GRCh37/hg19

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1365 users visited in the last hour