User: woongjaej

gravatar for woongjaej
woongjaej10
Reputation:
10
Status:
New User
Location:
Last seen:
3 weeks, 3 days ago
Joined:
5 months ago
Email:
w********@gmail.com

Posts by woongjaej

<prev • 21 results • page 1 of 3 • next >
0
votes
0
answers
106
views
0
answers
How to analysis 4c seq 3c seq data
... Hi, guys I have 3c seq fastq raw data. I searched how to analysis 3c seq data and got confused. I think basic analysis pipeline of 3c seq is different from other sequencings, right? For example, for other sequencing data, I first trim and QC the raw reads and get in to alignment with reference g ...
alignment 3c seq 4c seq written 5 weeks ago by woongjaej10
0
votes
1
answer
172
views
1
answers
Comment: C: Are merged bam files and merge fastq file -> bam files same?
... Thank you Ryan. P.S : I'm learning a lot from your other issues's replies! ...
written 7 weeks ago by woongjaej10
0
votes
1
answer
106
views
1
answer
mapping rate of small rna-seq with different references
... Hi, folks I'm new to analysing small RNa-seq and I have some questions. Hope some experts analysing small RNA-seq could give me some advices. 1. I'm mapping my single-end smRNA-seq data to hg19, hg38 references. I used Cap-mirseq pipeline to do this so the aligner was bowtie. When I got bam files, ...
smrna-seq reference mapping rate written 7 weeks ago by woongjaej10 • updated 7 weeks ago by sjbasu20
0
votes
1
answer
172
views
1
answers
Comment: C: Are merged bam files and merge fastq file -> bam files same?
... Thank you for the replies guys. So you mean I can either merge fastq files first and then process the mapping or process mapping first for the additional fastq file and then merge the bam file with existing bam file, right?? ...
written 7 weeks ago by woongjaej10
0
votes
1
answer
172
views
1
answer
Are merged bam files and merge fastq file -> bam files same?
... Hi, guys I'm processing NGS data and have a question. I need to make my data have over 100,000,000 reads, so when my first processing is done, I check if they are good to go. When the bam files are not over 100,000,000 reads, I sequence those libraries which are more needed. Here are the question ...
merge bam sequencing written 7 weeks ago by woongjaej10 • updated 7 weeks ago by Devon Ryan78k
0
votes
0
answers
239
views
0
answers
Comment: C: smRNA-seq adapter trimming cutadapt
... Thank you genomax! I'll try to compare results from the both. Thank you for your advice ...
written 3 months ago by woongjaej10
0
votes
0
answers
239
views
0
answers
Comment: C: smRNA-seq adapter trimming cutadapt
... I tried to compare the tow runs. First trimming result tells me it trimmed for 13298819 items for the first adapter. And then second trimming tells me it trimmed for 432477 items. Doesn't this mean cutadapt failed to trim for all of the "TGGAATTCTCGGGTGCCAAGG" adapter sequences?? ...
written 3 months ago by woongjaej10
0
votes
0
answers
239
views
0
answers
smRNA-seq adapter trimming cutadapt
... Hi, guys. I'm having trouble using cutadapt to trim the raw read(single-end) of small RNA seq.(Illumina TruSeq) I got the index information of the adapter from the sequencing facility. So I tried to trim adapters using cutadapt like below > cutadapt -b TGGAATTCTCGGGTGCCAAGG -b > AACTCCAGTCAC ...
illumina trimming smrna-seq cutadapt written 3 months ago by woongjaej10
0
votes
0
answers
369
views
0
answers
Comment: C: Cutadapt using issue
... Thank you Chen! I'll take a look at fastp you recommended! Sorry but now I must use trim_galore because of an order. Thank you very much for your recommendation ...
written 4 months ago by woongjaej10
0
votes
0
answers
369
views
0
answers
Cutadapt using issue
... Hi, guys I have an issue using trim_galore I have two computers(linux) and installed trim_galore which uses cutadapt 1.15 version in both computers. One, it works fine but the other one gives me error message below. No quality encoding type selected. Assuming that the data provided use ...
trimming trim_galore cutadapt written 4 months ago by woongjaej10 • updated 9 weeks ago by Biostar ♦♦ 20

Latest awards to woongjaej

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1921 users visited in the last hour