User: woongjaej

gravatar for woongjaej
woongjaej10
Reputation:
10
Status:
New User
Location:
Last seen:
41 minutes ago
Joined:
7 months, 3 weeks ago
Email:
w********@gmail.com

Posts by woongjaej

<prev • 24 results • page 1 of 3 • next >
0
votes
0
answers
62
views
0
answers
qualimap transcript coverage profile truncated in smRNA-seq( ENCODE PIPELINE)
... Hi, guys. I'm processing some smRNA-seq data which are single-end data with STAR. (ENCODE PIPELINE guide line) But when I do QC with qualimap2 after the alignment, some samples get strange value or no values at the transcript coverage profile lines. (ex. absence or some weird value like 477) Does ...
qaulimap2 smrna-seq star written 19 days ago by woongjaej10
0
votes
1
answer
146
views
1
answers
Comment: C: sequencing of control sample in ChIP-seq??
... Thank Ryan for kind reply!! ...
written 7 weeks ago by woongjaej10
1
vote
1
answer
146
views
1
answer
sequencing of control sample in ChIP-seq??
... Hi guys, I'm trying to analysis ChIP-seq data and have a question about control sample. First, I sequenced my samples about 2 G bases to check the quality of the samples and libraries. I have verified samples' qualities and decided to sequence deeper for these samples. Assuming that I will read ...
chip-seq sequencing written 7 weeks ago by woongjaej10 • updated 7 weeks ago by Devon Ryan81k
0
votes
0
answers
196
views
0
answers
How to analysis 4c seq 3c seq data
... Hi, guys I have 3c seq fastq raw data. I searched how to analysis 3c seq data and got confused. I think basic analysis pipeline of 3c seq is different from other sequencings, right? For example, for other sequencing data, I first trim and QC the raw reads and get in to alignment with reference g ...
alignment 3c seq 4c seq written 4 months ago by woongjaej10
0
votes
1
answer
300
views
1
answers
Comment: C: Are merged bam files and merge fastq file -> bam files same?
... Thank you Ryan. P.S : I'm learning a lot from your other issues's replies! ...
written 4 months ago by woongjaej10
0
votes
1
answer
188
views
1
answer
mapping rate of small rna-seq with different references
... Hi, folks I'm new to analysing small RNa-seq and I have some questions. Hope some experts analysing small RNA-seq could give me some advices. 1. I'm mapping my single-end smRNA-seq data to hg19, hg38 references. I used Cap-mirseq pipeline to do this so the aligner was bowtie. When I got bam files, ...
smrna-seq reference mapping rate written 4 months ago by woongjaej10 • updated 4 months ago by sjbasu30
0
votes
1
answer
300
views
1
answers
Comment: C: Are merged bam files and merge fastq file -> bam files same?
... Thank you for the replies guys. So you mean I can either merge fastq files first and then process the mapping or process mapping first for the additional fastq file and then merge the bam file with existing bam file, right?? ...
written 4 months ago by woongjaej10
0
votes
1
answer
300
views
1
answer
Are merged bam files and merge fastq file -> bam files same?
... Hi, guys I'm processing NGS data and have a question. I need to make my data have over 100,000,000 reads, so when my first processing is done, I check if they are good to go. When the bam files are not over 100,000,000 reads, I sequence those libraries which are more needed. Here are the question ...
merge bam sequencing written 4 months ago by woongjaej10 • updated 4 months ago by Devon Ryan81k
0
votes
0
answers
349
views
0
answers
Comment: C: smRNA-seq adapter trimming cutadapt
... Thank you genomax! I'll try to compare results from the both. Thank you for your advice ...
written 6 months ago by woongjaej10
0
votes
0
answers
349
views
0
answers
Comment: C: smRNA-seq adapter trimming cutadapt
... I tried to compare the tow runs. First trimming result tells me it trimmed for 13298819 items for the first adapter. And then second trimming tells me it trimmed for 432477 items. Doesn't this mean cutadapt failed to trim for all of the "TGGAATTCTCGGGTGCCAAGG" adapter sequences?? ...
written 6 months ago by woongjaej10

Latest awards to woongjaej

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 704 users visited in the last hour