User: woongjaej

gravatar for woongjaej
woongjaej10
Reputation:
10
Status:
New User
Location:
Last seen:
3 days, 12 hours ago
Joined:
1 month, 3 weeks ago
Email:
w********@gmail.com

Posts by woongjaej

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
89
views
0
answers
Comment: C: smRNA-seq adapter trimming cutadapt
... Thank you genomax! I'll try to compare results from the both. Thank you for your advice ...
written 17 days ago by woongjaej10
0
votes
0
answers
89
views
0
answers
Comment: C: smRNA-seq adapter trimming cutadapt
... I tried to compare the tow runs. First trimming result tells me it trimmed for 13298819 items for the first adapter. And then second trimming tells me it trimmed for 432477 items. Doesn't this mean cutadapt failed to trim for all of the "TGGAATTCTCGGGTGCCAAGG" adapter sequences?? ...
written 18 days ago by woongjaej10
0
votes
0
answers
89
views
0
answers
smRNA-seq adapter trimming cutadapt
... Hi, guys. I'm having trouble using cutadapt to trim the raw read(single-end) of small RNA seq.(Illumina TruSeq) I got the index information of the adapter from the sequencing facility. So I tried to trim adapters using cutadapt like below > cutadapt -b TGGAATTCTCGGGTGCCAAGG -b > AACTCCAGTCAC ...
illumina trimming smrna-seq cutadapt written 18 days ago by woongjaej10
0
votes
0
answers
191
views
0
answers
Comment: C: Cutadapt using issue
... Thank you Chen! I'll take a look at fastp you recommended! Sorry but now I must use trim_galore because of an order. Thank you very much for your recommendation ...
written 4 weeks ago by woongjaej10
0
votes
0
answers
191
views
0
answers
Cutadapt using issue
... Hi, guys I have an issue using trim_galore I have two computers(linux) and installed trim_galore which uses cutadapt 1.15 version in both computers. One, it works fine but the other one gives me error message below. No quality encoding type selected. Assuming that the data provided use ...
trimming trim_galore cutadapt written 4 weeks ago by woongjaej10
0
votes
1
answer
185
views
1
answers
Comment: C: trimming RNA-seq reads with adapter sequence?index? using trimmomatic
... Thanks a lot!! I'll try my customized adapter fasta and TruSeq3 file as you suggested, both and then compare them! Thank you for your kind explainations and pointers Jacob :) Woongjae ...
written 6 weeks ago by woongjaej10
0
votes
1
answer
185
views
1
answers
Comment: C: trimming RNA-seq reads with adapter sequence?index? using trimmomatic
... Thanks for your reply Jacob. I'm wondering if you could give me some advise making custom .fa file with my index info, please. Is it possible? Thanks Woongjae ...
written 6 weeks ago by woongjaej10
1
vote
1
answer
185
views
1
answer
trimming RNA-seq reads with adapter sequence?index? using trimmomatic
... Hi, guys. I have a question using trimmomatic to trim adapters from the RNA-seq reads. I have to QC the reads using trimmomatic but I wonder how it's done. For example, the sequencing company gave me that the data they gave me were made by "TruSeq Stranded mRNA LT Sample Prep Kit" and say they u ...
trimmomatic adapter rna-seq trim written 6 weeks ago by woongjaej10 • updated 6 weeks ago by Jacob Warner570
0
votes
1
answer
154
views
1
answers
Comment: C: Identify differentially expressed genes in scatter plot
... Thanks for your reply Ather! Is there any tutorials for such things using ggplot or seaborn, I can get the idea? ...
written 7 weeks ago by woongjaej10
0
votes
0
answers
1.6k
views
0
answers
Comment: C: How to plot ChIP-seq Density vs Distance from TSS using Homer annoted files
... Thank you Sinji! Your comments really helped me! ...
written 7 weeks ago by woongjaej10

Latest awards to woongjaej

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 617 users visited in the last hour