User: Shred

gravatar for Shred
Shred100
Reputation:
100
Status:
Trusted
Location:
Last seen:
26 minutes ago
Joined:
10 months, 3 weeks ago
Email:
d************@studenti.unipr.it

Posts by Shred

<prev • 33 results • page 1 of 4 • next >
1
vote
2
answers
107
views
2
answers
Comment: C: GenBank features don't extract sequences based on condition Biopython
... `intergenic sequence` is a list declared before, not copied just to be short. ...
written 13 hours ago by Shred100
0
votes
2
answers
107
views
2
answers
Comment: C: GenBank features don't extract sequences based on condition Biopython
... I'm downloading genomes using keywords from assembly. Thanks for that, I'll have a look to the linked document, but I guess is still a bad answer. I'm using a tool like Biopython, intended to be used to do tasks with designed object and class, and apparently there's no reason why it does the work ba ...
written 19 hours ago by Shred100
0
votes
2
answers
107
views
2
answers
Comment: C: GenBank features don't extract sequences based on condition Biopython
... Not a good solution, because I'm using multiple genomes, as can be seen at line 1. ...
written 20 hours ago by Shred100
0
votes
2
answers
107
views
2
answers
Comment: C: GenBank features don't extract sequences based on condition Biopython
... Sure, here's one. Bifidobacterium bifidum PRL2010 (https://www.ncbi.nlm.nih.gov/assembly/GCA_000165905.1) ...
written 21 hours ago by Shred100
0
votes
2
answers
107
views
2
answers
Comment: C: GenBank features don't extract sequences based on condition Biopython
... The key `rRNA` seems to work if I want to extract a 16S rRNA gene. Every genome tested was open previously with `artemis` where the search by key gives the right output every time. By far, I don't get why other condition values true even if they're explicitly wrong. I'm looking for gene with `16S` ...
written 23 hours ago by Shred100
3
votes
2
answers
107
views
2
answers
GenBank features don't extract sequences based on condition Biopython
... Guys, I've wrote a script to extract sequences between the 23S rRNA and 16S rRNA gene in Python using Biopython. I can't figure out why, even if I've set explicit conditions, it keeps extracting randome sequences into the genome. Here's the code: for f in glob.glob(cwd+'/genomes/*.gbk'): ...
annotation biopython genbank written 1 day ago by Shred100 • updated 15 hours ago by jrj.healey9.7k
1
vote
1
answer
92
views
1
answers
Comment: C: Trim sequences based on alignment in python
... Ops, I'm sorry. Maybe I forget to add the `:` initially when I wrote the code into Pycharm, that's why it doesn't work. I've used this syntax because I thought it's necessary to use a range starting from `position` to `:` (which is literally a bad way to intend the whole row). Thanks for the explana ...
written 7 days ago by Shred100
0
votes
1
answer
92
views
1
answers
Comment: C: Trim sequences based on alignment in python
... Thanks a lot for the help. Works properly. So `col` is referred to column into the array, which is the equivalent in term of rows? I find `AlignIO` documentation really lackful for help (or maybe is just me). Your last print statement just print out all the letters inside the position found, not th ...
written 7 days ago by Shred100
0
votes
1
answer
92
views
1
answers
Comment: C: Trim sequences based on alignment in python
... Got just the alignment done against the first two sequences. CLUSTAL 2.1 multiple sequence alignment ITS_primer_fw -------------------------------------------------- RBL67ITS_full_sequence CCCACACACGGGGAACCCGCAAGACCAAACGAACACCGGACGACAGATCA PRL2010 ...
written 7 days ago by Shred100
0
votes
1
answer
92
views
1
answers
Comment: C: Trim sequences based on alignment in python
... Yes, first position occupied in all the columns. ...
written 7 days ago by Shred100

Latest awards to Shred

Popular Question 6 months ago, created a question with more than 1,000 views. For Faster way to get GC content and Coverage from .fasta
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: How can I find the same record in two file? Use python
Teacher 10 months ago, created an answer with at least 3 up-votes. For A: How can I find the same record in two file? Use python
Scholar 10 months ago, created an answer that has been accepted. For A: Faster way to get GC content and Coverage from .fasta

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1783 users visited in the last hour