User: danilo.tatoni

gravatar for danilo.tatoni
Reputation:
60
Status:
New User
Location:
Last seen:
10 hours ago
Joined:
2 months, 3 weeks ago
Email:
d************@studenti.unipr.it

Posts by danilo.tatoni

<prev • 11 results • page 1 of 2 • next >
3
votes
1
answer
122
views
1
answers
Answer: A: Perl script required
... Don't need to be in perl. If you're working with tab separated values (so outfmt 6) , you can easly do a filter with awk. Assuming evalue is on the 4th column, thìs command will print only lines where evalue is *lower* than 0.02 awk -F'\t' '$4 < 0.02 {print ;}' Same things could be done wi ...
written 7 days ago by danilo.tatoni60
0
votes
0
answers
74
views
0
answers
Comment: C: Display full information about taxa instead of staxids in BLASTn
... I'm looking for scientific names. I've tried using ssciname, but I still don't get the wanted results. ...
written 4 weeks ago by danilo.tatoni60
0
votes
0
answers
74
views
0
answers
Display full information about taxa instead of staxids in BLASTn
... Hi guys, I'm new at using BLAST locally from command line. I'm trying to find a way to display the full taxonomy information instead of staxid in Blastn output. Here's the command using till today: $ blastn -query contigs.fasta -db BacteriaDB -evalue 10 -outfmt "7 qseqid qlen slen qcovhsp sseqi ...
taxonomy genomic blast written 4 weeks ago by danilo.tatoni60
0
votes
2
answers
176
views
2
answers
Comment: C: How can i summary my batch blast result to check the species distribution within
... By increasing e value cutoff and considering only high identity matches, lots of false positive will be cutted off . We're talking about prediction, so every software could consider false positive. ...
written 9 weeks ago by danilo.tatoni60
0
votes
2
answers
176
views
2
answers
Answer: A: How can i summary my batch blast result to check the species distribution within
... While working with huge file, go locally. My suggest is to use Rapsearch2 (https://github.com/zhaoyanswill/RAPSearch2) , making a database only with bacterial sequence (just download archives from NCBI , and make the database with prerapsearch, which is included in RapSearch package), then launch yo ...
written 9 weeks ago by danilo.tatoni60
0
votes
3
answers
332
views
3
answers
Comment: C: Faster way to get GC content and Coverage from .fasta
... Man, please explain me the reason why you wrote this answer, except to promote your sample code. ...
written 10 weeks ago by danilo.tatoni60
3
votes
2
answers
209
views
2
answers
Answer: A: How can I find the same record in two file? Use python
... The problem is that you didn't split the record by line. You can easly do it without using SeqIO module, but easly with regular python syntax. Credits: https://stackoverflow.com/questions/9585218/python-find-common-text-in-two-files > file1 = set(line.strip() for line in open('file1.txt') ...
written 10 weeks ago by danilo.tatoni60 • updated 10 weeks ago by WouterDeCoster28k
1
vote
3
answers
332
views
3
answers
Answer: A: Faster way to get GC content and Coverage from .fasta
... As a lesson to everyone, I've found the solution by using just awk, instead of creating a while read loop. Here's the work-around: awk -F '_' -v Y="$Y" '{ if(NR%2==1) { printf "%s %s %s %s %s\nnucleotidic_cov : %.4f\n",$1,$2,$3,$4,$5, ($6 / Y) } else { x=gsub(/[AT]/,""); ...
written 10 weeks ago by danilo.tatoni60
0
votes
1
answer
176
views
1
answers
Comment: C: updating a cell in a file
... The same. Just add "\t" instead of text. sed -i '1 i\\t' yourfile ...
written 12 weeks ago by danilo.tatoni60
2
votes
3
answers
332
views
6 follow
3
answers
Faster way to get GC content and Coverage from .fasta
... Guys, I've got a .fasta file , with the usual scheme >NODE XX _ lenght XX_cov.xx.xx ACGACGACGACACTCTACAGATACGACAT >NODE YY_lenght YY_cov.YY.YY CGACGACATCAGCATACAGATACTA I wrote a small script to get the GC content of each contig sequence, and so on, to convert the "cov." val ...
genome fasta next-gen sequencing bash written 12 weeks ago by danilo.tatoni60 • updated 10 weeks ago by cpad01125.3k

Latest awards to danilo.tatoni

Teacher 7 days ago, created an answer with at least 3 up-votes. For A: How can I find the same record in two file? Use python
Teacher 10 weeks ago, created an answer with at least 3 up-votes. For A: How can I find the same record in two file? Use python
Scholar 10 weeks ago, created an answer that has been accepted. For A: Faster way to get GC content and Coverage from .fasta

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1147 users visited in the last hour