User: rbagnall

gravatar for rbagnall
rbagnall1.5k
Reputation:
1,510
Status:
Trusted
Location:
Australia
Last seen:
21 hours ago
Joined:
7 years, 9 months ago
Email:
r*******@hotmail.com

about me

Posts by rbagnall

<prev • 114 results • page 1 of 12 • next >
2
votes
1
answer
54
views
1
answers
Answer: A: GNOMAD exome vcf field missing? number of hemizygous individuals
... Lets look at a gene on the X chromosome, say [F8][1] There is a variant at `X-154065843-G-A`, which is found in 103 males in the exome data and 92 males in the genome data, giving a total of 195 males who have this variant and are hemizygous. Now lets get the male allele count (thus number of hemi ...
written 21 hours ago by rbagnall1.5k
1
vote
1
answer
88
views
1
answers
Comment: C: Flanking sequence retreival
... Samtools time samtools faidx Homo_sapiens_assembly38.fasta chr8:300000-300050 >chr8:300000-300050 GACCACTTGTTCTGCATTTTCTCCATCTTCCTTGTGATTAGAAACCTCAAA real 0m0.174s user 0m0.003s sys 0m0.024s Bedtools time bedtools getfasta -fi Homo_sapiens_assembly38.fa ...
written 5 days ago by rbagnall1.5k
1
vote
1
answer
88
views
1
answers
Answer: A: Flanking sequence retreival
... Extract subsequence from indexed reference sequence using [samtools faidx][1]. samtools faidx your.fasta chrX:start-end [1]: http://www.htslib.org/doc/samtools-faidx.1.html ...
written 6 days ago by rbagnall1.5k
2
votes
1
answer
91
views
1
answers
Answer: A: Limitation of UKBB genotyping/sequencing data in drug target identificantion
... From the UK biobank "The UK Biobank 50k WES FE dataset is incorrectly mapped in a non-alt-aware manner." See the paper describing the issue [here][1] (BioRxiv) Download the pdf comment/response from the UK Biobank [here][2] [1]: https://www.biorxiv.org/content/10.1101/868570v1 [2]: https: ...
written 6 weeks ago by rbagnall1.5k
2
votes
1
answer
147
views
1
answers
Comment: C: Is 1 deleted T in a T stretch always detected, assuming enough coverage of cours
... Sorry.., you are right, that was for vcf files, but the principal is the same for BAM files. You will never which T was deleted. The convention is to left align indels at these positions in each read, and this can be done on BAM files using, for example, the GATK [LeftAlignIndels][1] tool. For som ...
written 7 weeks ago by rbagnall1.5k
0
votes
1
answer
147
views
1
answers
Comment: C: Is 1 deleted T in a T stretch always detected, assuming enough coverage of cours
... [left align indels][1] [1]: https://www.biostars.org/p/66843/ ...
written 7 weeks ago by rbagnall1.5k
1
vote
1
answer
99
views
1
answers
Answer: A: How to effectively use GATK haplotype caller with -L breaking up BAM files
... You want to pass the first 10,000 scaffolds in a text file called an [interval list][1] `-L path/to/my_interval.list` Where an interval list file to include the first four scaffolds would look like: `scaffold1` `scaffold2` `scaffold3` `scaffold4` This will give a single g.vcf for the firs ...
written 9 weeks ago by rbagnall1.5k
1
vote
0
answers
149
views
0
answers
Comment: C: Extract variants from genomic range from gnomAD GRCh38
... Are you using intervals in the format chrY:XXXX-XXXX ? The older versions of gnomAD were mapped to hg19, with chromosome names like 1,2,3,X,Y The new version 3 of gnomAD is mapped to GRCh38, with chromosome names like chr1, chr2, chrX, chrY ...
written 12 weeks ago by rbagnall1.5k
1
vote
2
answers
359
views
2
answers
Answer: C: awk extract certain line
... In addition to the excel line ending issue, your grep command won't work because of the `-w` (grep the exact match). If you remove the `-w` then TRINITY_DN100000_c1_g1 of file1.txt will pick out TRINITY_DN100000_c1_g1_1 TRINITY_DN100000_c1_g1_2 TRINITY_DN100000_c1_g1_3 of file2. ...
written 5 months ago by rbagnall1.5k
2
votes
1
answer
253
views
1
answers
Comment: C: how can a DELETION be not a NULL variant?
... Precisely! In this case it is a deletion of 3 base pairs in the coding region of ROBO2 (ACAG goes to A by loss of CAG). Therefore it is an 'in-frame' deletion, which causes the protein to be shortened by one amino acid residue. ...
written 6 months ago by rbagnall1.5k

Latest awards to rbagnall

Popular Question 4 weeks ago, created a question with more than 1,000 views. For LOD score of a single genotype
Scholar 10 weeks ago, created an answer that has been accepted. For A: 1000 Genomes and ESP Populations in Exome Aggregation Consortium Data
Scholar 3 months ago, created an answer that has been accepted. For A: 1000 Genomes and ESP Populations in Exome Aggregation Consortium Data
Commentator 3 months ago, created a comment with at least 3 up-votes. For C: How to extract specific chromosome from vcf file
Appreciated 10 months ago, created a post with more than 5 votes. For A: Grep A Pattern From File
Teacher 10 months ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File
Centurion 17 months ago, created 100 posts.
Teacher 18 months ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File
Teacher 18 months ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File
Good Answer 21 months ago, created an answer that was upvoted at least 5 times. For A: Grep A Pattern From File
Appreciated 2.2 years ago, created a post with more than 5 votes. For A: Grep A Pattern From File
Popular Question 2.2 years ago, created a question with more than 1,000 views. For LOD score of a single genotype
Scholar 2.5 years ago, created an answer that has been accepted. For A: 1000 Genomes and ESP Populations in Exome Aggregation Consortium Data
Commentator 3.5 years ago, created a comment with at least 3 up-votes. For C: How to extract specific chromosome from vcf file
Guru 3.8 years ago, received more than 100 upvotes.
Teacher 3.8 years ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File
Scholar 3.9 years ago, created an answer that has been accepted. For A: Trouble filtering CDS regions from Nextera Enrichment design
Teacher 3.9 years ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File
Appreciated 3.9 years ago, created a post with more than 5 votes. For A: Grep A Pattern From File
Teacher 3.9 years ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Free HiSeq X Ten human genome fastq test data
Teacher 4.5 years ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File
Scholar 4.6 years ago, created an answer that has been accepted. For A: Trouble filtering CDS regions from Nextera Enrichment design
Teacher 4.6 years ago, created an answer with at least 3 up-votes. For A: Grep A Pattern From File

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1069 users visited in the last hour