User: Darill

gravatar for Darill
Darill40
Reputation:
40
Status:
New User
Location:
Last seen:
1 day, 9 hours ago
Joined:
1 year, 10 months ago
Email:
b****************@gmail.com

Posts by Darill

<prev • 113 results • page 1 of 12 • next >
0
votes
0
answers
84
views
0
answers
Comment: C: Remove sequence by coordinates with Biopython
... thank you for your help ...
written 22 days ago by Darill40
0
votes
0
answers
84
views
0
answers
Comment: C: Remove sequence by coordinates with Biopython
... I see what you mean but here It is an easy example, in the real data I can have thousands of coordinates, I added another exemple in order to show you. ...
written 22 days ago by Darill40
1
vote
0
answers
84
views
0
answers
Remove sequence by coordinates with Biopython
... Hel lo I have a sequence such as : record_dict = SeqIO.to_dict(SeqIO.parse("sequence.fasta", "fasta")) >sequence1 AAACCCGGGTTTAAACCCGGGTTTGGGTTTGGG and I know from this sequence how to select specific part with coordinates with : print(record_dict[sequence1].seq[coordinate_ ...
fasta biopython written 22 days ago by Darill40
0
votes
0
answers
97
views
0
answers
Hisat2 --sra-acc option (redirect sra file to a desired directory)
... Hello, I'm actually using `Hisat2` and its option `--sra-acc` /beegfs/data/mycount/TOOLS/hisat2-2.1.0/hisat2 -k 1 -q -x mapping_index --sra-acc SRR5074460 | $SAMTOOLS/samtools view -o mapping.bam 2> stats_mapping.txt But the probleme is here, the sra files are savec to the wroung desired ...
ncbi sra hisat2 written 8 weeks ago by Darill40
1
vote
1
answer
11k
views
1
answers
Comment: C: Fast download of FASTQ files from the European Nucleotide Archive (ENA)
... Ok thank you I will figure it out :) ...
written 9 weeks ago by Darill40
0
votes
1
answer
170
views
1
answers
Comment: C: Access to SRA read from a specific genome assembly on NCBI
... @genomax is there a way to get a table from that such as: Accession Instrument Total Bases (Mb) Date Created SRR947092. Illumina HiSeq 2000 66274 03 Aug 2013 ...
written 9 weeks ago by Darill40
0
votes
2
answers
164
views
2
answers
Comment: C: Set the max coverage wanted with Hisat2 ?
... @ATpoint thank you very much for all this information it was very helpfull! ...
written 9 weeks ago by Darill40
0
votes
2
answers
164
views
2
answers
Comment: C: Set the max coverage wanted with Hisat2 ?
... I was talking about the hard disk space sorry. So if I desire a coverage mapping of 10X I have to put -u 10 right ? ...
written 9 weeks ago by Darill40
3
votes
2
answers
164
views
2
answers
Set the max coverage wanted with Hisat2 ?
... Hello everyone, I'm actually using Hisat in order to map reads against one genome. Here is the job file : FILE=Genome.fa READS1a=SRR9110374_1.fastq.gz READS2a=SRR9110374_2.fastq.gz ############################################################### # SOFTWARES ...
mapping hisat2 written 9 weeks ago by Darill40
0
votes
0
answers
98
views
0
answers
Codon substitution model (codeml)
... Hello, I'm actually using codeml implemented into PAML and I wondered if there where not another codon substitution model than Goldman and Yang (1994) present into codeml? I know tha there is another another one but I cannot manage to find it. Does anyone have the paper that talks of this model ...
dnds codeml paml written 9 weeks ago by Darill40 • updated 10 days ago by Biostar ♦♦ 20

Latest awards to Darill

Popular Question 8 months ago, created a question with more than 1,000 views. For Cannot install NumPy using pip and import it
Popular Question 8 months ago, created a question with more than 1,000 views. For compare 2 dataframe with pandas
Centurion 8 months ago, created 100 posts.
Epic Question 8 months ago, created a question with more than 10,000 views. For C extension: No module named 'pandas._libs.tslib' not built (pandas)
Popular Question 8 months ago, created a question with more than 1,000 views. For Cannot install NumPy using pip and import it
Popular Question 10 months ago, created a question with more than 1,000 views. For Cannot install NumPy using pip and import it
Popular Question 12 months ago, created a question with more than 1,000 views. For compare 2 dataframe with pandas
Great Question 13 months ago, created a question with more than 5,000 views. For compare 2 dataframe with pandas
Great Question 15 months ago, created a question with more than 5,000 views. For C extension: No module named 'pandas._libs.tslib' not built (pandas)
Popular Question 17 months ago, created a question with more than 1,000 views. For compare 2 dataframe with pandas
Popular Question 19 months ago, created a question with more than 1,000 views. For compare 2 dataframe with pandas
Popular Question 19 months ago, created a question with more than 1,000 views. For C extension: No module named 'pandas._libs.tslib' not built (pandas)
Rising Star 21 months ago, created 50 posts within first three months of joining.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1804 users visited in the last hour