Moderator: shenwei356

gravatar for shenwei356
shenwei3564.0k
Reputation:
4,020
Status:
Trusted
Location:
China
Website:
http://shenwei.me/
Twitter:
shenwei356
Scholar ID:
Google Scholar Page
Last seen:
7 hours ago
Joined:
6 years, 3 months ago
Email:
s*********@gmail.com

Posts by shenwei356

<prev • 461 results • page 1 of 47 • next >
7
votes
5
answers
390
views
5
answers
Comment: C: How to make bash script operate fast for a 13gb VCF.gz file with 900000 rows and
... https://www.biostars.org/p/63816/ But I think you should write a script to avoid read the data file thousands times. ...
written 11 days ago by shenwei3564.0k
0
votes
3
answers
85
views
3
answers
Comment: C: How can I add an incremented value just after Accession no. ?
... oh, you can google it ...
written 17 days ago by shenwei3564.0k
1
vote
3
answers
85
views
3
answers
Answer: A: How can I add an incremented value just after Accession no. ?
... $ seqkit replace -p '^(.+?) (.+)' -r '${1}_{nr} $2' --nr-width 9 -w 0 seq.fa >NZ_CP00000.1_000000001 volvox complete genome AAAAAAAATGTGCTCCGGCCTCCGCGAAATTCGCGACGCCGGCCGCGTGGGCATGCACGTC >NZ_CP00000.1_000000002 volvox complete genome GGCCGTTACCTGGAGCCAGCGGGACTCGAAGGATGCCCCAC ...
written 17 days ago by shenwei3564.0k
1
vote
4
answers
189
views
4
answers
Answer: A: How to re-order (sort) to get top values for each column in excel sheet of OTUs?
... Well, just for fun. Here's a long one-liner using [csvtk](https://github.com/shenwei356/csvtk) and [rush](https://github.com/shenwei356/rush) (can be replaced with [GNU parallel](https://www.gnu.org/software/parallel/)). You can run this in Windows if you install the windows version ! csvtk xls ...
written 18 days ago by shenwei3564.0k
0
votes
2
answers
785
views
2
answers
Comment: C: extracting sequences from a fasta file
... For you seqkit grep -n -f ids.txt seqs.fa -o result.fa `[ERRO] fastx: stdin not detected` means no input file provided and stdin not detected. ...
written 20 days ago by shenwei3564.0k
1
vote
3
answers
199
views
3
answers
Comment: C: Batch rename *fastq.gz files using regular expression
... thanks for pointing out, if you have ran with the old command, you can run 'brename -u' to undo. ...
written 26 days ago by shenwei3564.0k
4
votes
3
answers
199
views
3
answers
Answer: A: Batch rename *fastq.gz files using regular expression
... Try safe-batch-rename tool `brename` ( https://github.com/shenwei356/brename ) brename -p '^(\w+?)_.+_(R[12])_.+' -r '${1}_$2.fq.gz' # updated # original answer # brename -p '^(\w+)_.+_(R[12])_.+' -r '${1}_$2.fq.gz' # if you have ran this, you can run 'brename -u' to undo. ...
written 26 days ago by shenwei3564.0k
5
votes
4
answers
250
views
4
answers
Answer: A: awk specific line from another file
... simple with https://github.com/shenwei356/csvtk csvtk grep -H -t -f 4 -P file1 file2 > result ...
written 27 days ago by shenwei3564.0k
0
votes
0
answers
186
views
0
answers
Comment: C: my file do not have duplicates, but it still shows duplicate are not allow
... Why not show counting the first column? ...
written 29 days ago by shenwei3564.0k
1
vote
4
answers
199
views
4
answers
Comment: A: How to find common data in replicates?
... inner join. inner join. ...
written 5 weeks ago by shenwei3564.0k

Latest awards to shenwei356

Appreciated 11 days ago, created a post with more than 5 votes. For C: Inserting delim between numbers and strings in bash
Commentator 11 days ago, created a comment with at least 3 up-votes. For C: single line fasta to mult line fasta
Appreciated 21 days ago, created a post with more than 5 votes. For C: Inserting delim between numbers and strings in bash
Teacher 21 days ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Scholar 21 days ago, created an answer that has been accepted. For A: looking for 16S RNA sequence consensus
Teacher 26 days ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Scholar 26 days ago, created an answer that has been accepted. For A: looking for 16S RNA sequence consensus
Teacher 6 weeks ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Teacher 6 weeks ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Scholar 9 weeks ago, created an answer that has been accepted. For A: looking for 16S RNA sequence consensus
Teacher 9 weeks ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Good Answer 9 weeks ago, created an answer that was upvoted at least 5 times. For A: Bioinformatics software distribution
Teacher 9 weeks ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Scholar 9 weeks ago, created an answer that has been accepted. For A: looking for 16S RNA sequence consensus
Appreciated 9 weeks ago, created a post with more than 5 votes. For C: Inserting delim between numbers and strings in bash
Teacher 11 weeks ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Scholar 5 months ago, created an answer that has been accepted. For A: looking for 16S RNA sequence consensus
Popular Question 5 months ago, created a question with more than 1,000 views. For csvtk - a cross-platform, efficient, practical and pretty CSV/TSV toolkit
Appreciated 7 months ago, created a post with more than 5 votes. For C: Inserting delim between numbers and strings in bash
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Scholar 10 months ago, created an answer that has been accepted. For A: looking for 16S RNA sequence consensus
Scholar 10 months ago, created an answer that has been accepted. For A: looking for 16S RNA sequence consensus
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: single line fasta to mult line fasta
Scholar 13 months ago, created an answer that has been accepted. For A: looking for 16S RNA sequence consensus

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1876 users visited in the last hour