Moderator: a.zielezinski

gravatar for a.zielezinski
a.zielezinski8.3k
Reputation:
8,300
Status:
Trusted
Location:
Website:
http://andrzejz.home.a...
Twitter:
a_zielezinski
Scholar ID:
Google Scholar Page
Last seen:
15 hours ago
Joined:
6 years, 2 months ago
Email:
a************@gmail.com

Andrzej Zielezinski

Posts by a.zielezinski

<prev • 330 results • page 1 of 33 • next >
2
votes
0
answers
69
views
0
answers
Comment: C: How to prove one set of protein is more conserved than the other set?
... Generate all-versus-all pairwise global alignments in set A and calculate mean percent identity with standard deviation. Do the same for the sequences within set B. Then, depending on the distribution of identities apply t-test or Mann-Whitney test to see whether the difference between the two sets ...
written 3 days ago by a.zielezinski8.3k
0
votes
2
answers
485
views
2
answers
Comment: C: FlexiDot: highly customizable, ambiguity-aware dotplots
... Thank you very much. This feature is very helpful. I'm already showing FlexiDot to my students. ...
written 21 days ago by a.zielezinski8.3k
0
votes
2
answers
485
views
2
answers
Comment: C: FlexiDot: highly customizable, ambiguity-aware dotplots
... Wow! That's great news. I'm looking forward to it. My best wishes to the entire FlexiDot team. ...
written 4 weeks ago by a.zielezinski8.3k
1
vote
2
answers
485
views
2
answers
Comment: C: FlexiDot: highly customizable, ambiguity-aware dotplots
... It would be great to have an option to display dotplots according to cartesian coordinate system (i.e., Y axis from bottom to top, rather than from top to bottom). ...
written 4 weeks ago by a.zielezinski8.3k
0
votes
2
answers
485
views
2
answers
Comment: C: FlexiDot: highly customizable, ambiguity-aware dotplots
... IMO, the best software for creating dotplots. ...
written 4 weeks ago by a.zielezinski8.3k
1
vote
0
answers
122
views
0
answers
Comment: C: K-mer analysis meaning
... Very clearly written and understandable [blog post about k-mers][1]. [1]: http://ivory.idyll.org/blog/2017-something-about-kmers.html ...
written 8 weeks ago by a.zielezinski8.3k
1
vote
0
answers
140
views
0
answers
Comment: C: Why these blast bitscores are low?
... Bitscore in sequence alignment is calculated based on substitution scoring matrix. In BLASTp, the default matrix is [BLOSUM62][1]. You can see that different amino acid matches have different scores - for example, bitscore for the `W-W` match is `11` and bitscore for `G-G` is `6`. That's way, it is ...
written 3 months ago by a.zielezinski8.3k
0
votes
0
answers
263
views
0
answers
Comment: C: Different alignment results between Emboss Needle and Biopython pairwise2
... I'm using BioPython 1.70. ...
written 3 months ago by a.zielezinski8.3k
0
votes
0
answers
263
views
0
answers
Comment: C: Different alignment results between Emboss Needle and Biopython pairwise2
... Wooo, you're right. I'm moving my answer as comment. I think the difference in alignments and scores may come from the fact that needle has two additional parameters (not present in biopython): `endopen` and `endextend`. ...
written 3 months ago by a.zielezinski8.3k
3
votes
0
answers
263
views
0
answers
Comment: A: Different alignment results between Emboss Needle and Biopython pairwise2
... I'm also getting different results. **Biopython:** from Bio import pairwise2 from Bio.pairwise2 import format_alignment seq1 = 'GGCATGTACCTGTCGTGTGCGTTGTATCCCCCACGCTTGATAGACGTAGAGCTGCCTTGTAACGTGGGAGTGAAA' seq2 = 'ACGATCTATGGGGCTAACTTCTCAGTTAGGAGGCTAAAACCTACAAATAACCCCACAACGACAC ...
written 3 months ago by a.zielezinski8.3k

Latest awards to a.zielezinski

Good Answer 12 weeks ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Commentator 3 months ago, created a comment with at least 3 up-votes. For C: 200Bp Long Query Returning 201Bp
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 3 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 4 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Appreciated 4 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 4 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 4 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Good Answer 5 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 5 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Appreciated 5 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Good Answer 5 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 5 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 5 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Good Answer 5 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 5 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 5 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 523 users visited in the last hour