Moderator: a.zielezinski

gravatar for a.zielezinski
a.zielezinski9.1k
Reputation:
9,060
Status:
Trusted
Location:
Website:
http://andrzejz.home.a...
Twitter:
a_zielezinski
Scholar ID:
Google Scholar Page
Last seen:
4 hours ago
Joined:
7 years, 11 months ago
Email:
a************@gmail.com

Andrzej Zielezinski

Posts by a.zielezinski

<prev • 369 results • page 1 of 37 • next >
0
votes
1
answer
60
views
1
answers
Comment: C: leafs in the MESH tree
... Agree, the .bin extension is misleading. ...
written 4 weeks ago by a.zielezinski9.1k
2
votes
1
answer
60
views
1
answers
Answer: A: leafs in the MESH tree
... MeSH trees are stored in the [ftp://nlmpubs.nlm.nih.gov/online/mesh/MESH_FILES/meshtrees/mtrees2020.bin][1] text file. However, you need to parse the file to get all the leaves. Few lines from the `mtrees2020.bin` file: Infections;C01 Aneurysm, Infected;C01.069 Arthritis, Infectious;C0 ...
written 4 weeks ago by a.zielezinski9.1k
3
votes
1
answer
131
views
1
answers
Answer: A: Biopython gives ValueError: Sequences must all be the same length even though se
... The problem is with your `msa.phy` file. Phylip format has [certain specifications][1]. Your file should look like this: 3 253 esv1 TACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAAAGCGGAATTCCACGTGT ...
written 6 weeks ago by a.zielezinski9.1k
1
vote
1
answer
180
views
1
answers
Comment: C: kraken and kraken2: Downloading taxonomy tree data...rsync: error while loading
... Try to install libiconv package by typing `conda install -c conda-forge libiconv` ...
written 6 weeks ago by a.zielezinski9.1k
1
vote
1
answer
137
views
1
answers
Answer: C: Append only sequence itself to list, no metadata
... Replace `total.append(record.seq)` with `total.append(str(record.seq))`. ...
written 3 months ago by a.zielezinski9.1k
0
votes
2
answers
284
views
2
answers
Comment: C: Python- Searching codons using for/if
... Replace `codon==['ATG']` with `codon=='ATG'`. ...
written 4 months ago by a.zielezinski9.1k
3
votes
1
answer
177
views
1
answer
ETE3: error while parsing Newick tree
... Any idea why ETE Toolkit (ete3) throws an error while parsing the following Newick tree: > ((((A,B),C),(((D,E),F),(((((G,H),I),J),K),L)))(M,N)); from ete3 import Tree s = '((((A,B),C),(((D,E),F),(((((G,H),I),J),K),L)))(M,N));' t = Tree(s) The error message: ete3.parser.newick. ...
ete3 newick tree ete written 4 months ago by a.zielezinski9.1k • updated 4 months ago by Mensur Dlakic4.2k
0
votes
1
answer
1.6k
views
1
answers
Comment: C: BLOSUM62 in Python
... You can then transform this dictionary into a list or NumPy's array. ...
written 5 months ago by a.zielezinski9.1k
0
votes
1
answer
1.6k
views
1
answers
Answer: A: BLOSUM62 in Python
... blosum62 = { ('W', 'F'): 1, ('L', 'R'): -2, ('S', 'P'): -1, ('V', 'T'): 0, ('Q', 'Q'): 5, ('N', 'A'): -2, ('Z', 'Y'): -2, ('W', 'R'): -3, ('Q', 'A'): -1, ('S', 'D'): 0, ('H', 'H'): 8, ('S', 'H'): -1, ('H', 'D'): -1, ('L', 'N'): -3, ('W', 'A'): -3, ('Y', 'M'): -1, ...
written 5 months ago by a.zielezinski9.1k
0
votes
1
answer
265
views
1
answers
Answer: A: Local and global alignment combined
... As [@kuckunniwid][1] commented, you are looking for **semi-global alignment** (a.k.a **glocal**). I recommend the [needle][2] tool from EMBOSS package. By default, needle performs semi-global alignment (i.e., end gap penalties are disabled). You can play with the tool on-line or install it locally ...
written 6 months ago by a.zielezinski9.1k

Latest awards to a.zielezinski

Appreciated 28 days ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 4 weeks ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Scholar 6 weeks ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Good Answer 7 weeks ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Good Answer 10 weeks ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 10 weeks ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 3 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Good Answer 3 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Commentator 6 months ago, created a comment with at least 3 up-votes. For C: 200Bp Long Query Returning 201Bp
Scholar 6 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 6 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Commentator 7 months ago, created a comment with at least 3 up-votes. For C: 200Bp Long Query Returning 201Bp
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Appreciated 8 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 9 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 9 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Appreciated 10 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Good Answer 11 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Great Question 13 months ago, created a question with more than 5,000 views. For What Is The Lowest E-Value In Blast When Ncbi Rounds It Down To 0 (Zero)?
Good Answer 13 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Teacher 17 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Appreciated 17 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Good Answer 19 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1116 users visited in the last hour