Moderator: a.zielezinski

gravatar for a.zielezinski
a.zielezinski8.3k
Reputation:
8,260
Status:
Trusted
Location:
Website:
http://andrzejz.home.a...
Twitter:
a_zielezinski
Scholar ID:
Google Scholar Page
Last seen:
14 hours ago
Joined:
6 years ago
Email:
a************@gmail.com

Andrzej Zielezinski

Posts by a.zielezinski

<prev • 324 results • page 1 of 33 • next >
1
vote
0
answers
97
views
0
answers
Comment: C: Why these blast bitscores are low?
... Bitscore in sequence alignment is calculated based on substitution scoring matrix. In BLASTp, the default matrix is [BLOSUM62][1]. You can see that different amino acid matches have different scores - for example, bitscore for the `W-W` match is `11` and bitscore for `G-G` is `6`. That's way, it is ...
written 6 weeks ago by a.zielezinski8.3k
0
votes
0
answers
196
views
0
answers
Comment: C: Different alignment results between Emboss Needle and Biopython pairwise2
... I'm using BioPython 1.70. ...
written 6 weeks ago by a.zielezinski8.3k
0
votes
0
answers
196
views
0
answers
Comment: C: Different alignment results between Emboss Needle and Biopython pairwise2
... Wooo, you're right. I'm moving my answer as comment. I think the difference in alignments and scores may come from the fact that needle has two additional parameters (not present in biopython): `endopen` and `endextend`. ...
written 6 weeks ago by a.zielezinski8.3k
3
votes
0
answers
196
views
0
answers
Comment: A: Different alignment results between Emboss Needle and Biopython pairwise2
... I'm also getting different results. **Biopython:** from Bio import pairwise2 from Bio.pairwise2 import format_alignment seq1 = 'GGCATGTACCTGTCGTGTGCGTTGTATCCCCCACGCTTGATAGACGTAGAGCTGCCTTGTAACGTGGGAGTGAAA' seq2 = 'ACGATCTATGGGGCTAACTTCTCAGTTAGGAGGCTAAAACCTACAAATAACCCCACAACGACAC ...
written 6 weeks ago by a.zielezinski8.3k
0
votes
1
answer
258
views
1
answers
Comment: C: Retrieve all sequence ids from a master record
... Hmm.. that's interesting. I truly don't know how to interpret this case. I would also guess that this may have something to do with the database maintenance. Can we somehow deduce which of these two results is true - information in the master record (NZ_KB892637-NZ_KB892704) or results returned by e ...
written 7 weeks ago by a.zielezinski8.3k
1
vote
1
answer
207
views
1
answers
Comment: C: Select records from fasta file by SeqIO (Biopython)
... Yes, you are right. In the first `for` loop I iterate over each year. Then, I shuffle the list `d[year]` to make sure you have a random order of sequences for that year. At this point, `d[year]` contains all sequences for a given year (there may be more than 4 sequences). In the second `for` loop I ...
written 8 weeks ago by a.zielezinski8.3k
4
votes
1
answer
207
views
1
answers
Answer: A: Select records from fasta file by SeqIO (Biopython)
... This will do the job: import random from Bio import SeqIO d = {} year_st = 1958 year_en = 1990 for record in SeqIO.parse("Bluetong_batch_cds.txt", "fasta"): year = int(record.description[-4:]) if year >= year_st and year <= year_en: if ...
written 8 weeks ago by a.zielezinski8.3k
1
vote
1
answer
258
views
1
answers
Comment: C: Retrieve all sequence ids from a master record
... Sorry, somehow I missed your first question. I've just updated my answer. ...
written 8 weeks ago by a.zielezinski8.3k
4
votes
1
answer
258
views
1
answers
Answer: A: Retrieve all sequence ids from a master record
... > How can I identify automatically if a NCBI entry is such a master entry? Master records have distinguishable accession numbers. Each master record consists of a four-letter prefix followed by zeroes. The number of zeroes can be different - it increases to nine for Whole Genome Shotgun projects ...
written 8 weeks ago by a.zielezinski8.3k
0
votes
1
answer
254
views
1
answers
Comment: C: Where I can download separate complete human chromosome genomes in GenBank forma
... You're right! I thought im in RefSeq directory, but accidentally entered RefSeqGene. I fixed my answer. ...
written 9 weeks ago by a.zielezinski8.3k

Latest awards to a.zielezinski

Good Answer 26 days ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Commentator 6 weeks ago, created a comment with at least 3 up-votes. For C: 200Bp Long Query Returning 201Bp
Teacher 8 weeks ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 8 weeks ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 8 weeks ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 8 weeks ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Appreciated 10 weeks ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 10 weeks ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 10 weeks ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 10 weeks ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Good Answer 3 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 3 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Appreciated 3 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Good Answer 3 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 3 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 3 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Good Answer 3 months ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 3 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 3 months ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1066 users visited in the last hour