Moderator: a.zielezinski

gravatar for a.zielezinski
a.zielezinski7.8k
Reputation:
7,830
Status:
Trusted
Location:
Website:
http://andrzejz.home.a...
Twitter:
a_zielezinski
Scholar ID:
Google Scholar Page
Last seen:
6 hours ago
Joined:
5 years, 10 months ago
Email:
a************@gmail.com

Andrzej Zielezinski

Posts by a.zielezinski

<prev • 290 results • page 1 of 29 • next >
1
vote
2
answers
217
views
2
answers
Comment: C: Batch Renaming Files
... I updated my answer by adding a screenshot of my terminal on Mac. ...
written 11 days ago by a.zielezinski7.8k
0
votes
2
answers
217
views
2
answers
Comment: C: Batch Renaming Files
... Python scripts need to be executed from the command prompt (under Windows) or terminal (under Linux/MacOs). The prompt >>> indicates that you are now in an interactive Python interpeter session, also called the “Python shell”. This is different from the normal terminal command prompt. ...
written 12 days ago by a.zielezinski7.8k
6
votes
2
answers
217
views
2
answers
Answer: A: Batch Renaming Files
... Here's a solution in Python. It will work with different operating systems (Windows, Linux, MacOS, etc.). Make sure the script is in the same directory as the files you want to rename. **Python code** (`script.py`) import os import sys with open(sys.argv[1]) as fh: for li ...
written 12 days ago by a.zielezinski7.8k
1
vote
1
answer
88
views
1
answers
Answer: A: Blast e-value 0E0
... Very low e-values are rounded to zero. BLAST uses double float point representation, so e-values lower than approximately `5*10^−324` are rounded to 0. ...
written 15 days ago by a.zielezinski7.8k
6
votes
2
answers
171
views
2
answers
Answer: A: How to color nodes in Cytoscape according to expression of genes? How should the
... **INPUT DATA** You need two input files to color your network according to expression values in normal and cancer samples. First file defines interactions between genes. For example, Excel file (`interactions.xls`): Source Target Gene1 Gene2 Gene1 Gene3 Gene2 Gene3 Gene2 Gene4 ...
written 19 days ago by a.zielezinski7.8k
4
votes
1
answer
150
views
1
answers
Answer: A: Pass query and subject as string instead of files to blastn
... Python is using `/bin/sh` to run your command and it doesn't support process substitution. You need to manually use `/bin/bash` instead. Python 3: from subprocess import Popen, PIPE id1 = 'seq1' seq1 = 'TTGATGCAAAAGGCAAGATAATTACTAGTACAATATAGTCCC' id2 = 'seq2' seq2 = 'TTGAT ...
written 28 days ago by a.zielezinski7.8k
4
votes
3
answers
194
views
3
answers
Answer: A: How to count fasta sequences efficiently using (or not ) biopython
... Standard Python will be faster than BioPython: fh = open("test_fasta.fasta") n = 0 for line in fh: if line.startswith(">"): n += 1 fh.close() or shorter and possibly faster: num = len([1 for line in open("test_fasta.fasta") if line.startswith(">")]) ...
written 28 days ago by a.zielezinski7.8k
0
votes
1
answer
145
views
1
answers
Comment: C: Given two short sequences (~1000 bp) I want to find all local alignments between
... Does this answer your question? ...
written 29 days ago by a.zielezinski7.8k
0
votes
1
answer
145
views
1
answers
Comment: C: Given two short sequences (~1000 bp) I want to find all local alignments between
... By default, sequence masking is enabled in BLAST. To disable it, add these two arguments: `-soft_masking false -dust no`. ...
written 29 days ago by a.zielezinski7.8k
3
votes
1
answer
145
views
1
answers
Answer: A: Given two short sequences (~1000 bp) I want to find all local alignments between
... BLAST will give you all possible local alignments that satisify certain alignment parameters. Therefore, make sure you: 1. set high E-value (e.g. 10e+14) 2. set short word size (e.g. 4) 3. set low gap penalties 4. disable sequence masking. To run BLAST to align **only two sequences** (rather ...
written 29 days ago by a.zielezinski7.8k

Latest awards to a.zielezinski

Good Answer 8 days ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 10 days ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Appreciated 10 days ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 12 days ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Good Answer 13 days ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 13 days ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Scholar 19 days ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 19 days ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Teacher 26 days ago, created an answer with at least 3 up-votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 26 days ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Good Answer 26 days ago, created an answer that was upvoted at least 5 times. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 26 days ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Appreciated 28 days ago, created a post with more than 5 votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 28 days ago, created an answer with at least 3 up-votes. For A: How To Separate A List Of Genomics Regions Into Several Disjoint Subsets
Teacher 28 days ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 28 days ago, created an answer that has been accepted. For A: How to turn off low complexity filter in BLASTn?
Scholar 28 days ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 28 days ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 29 days ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Teacher 9 weeks ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 9 weeks ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file
Commentator 3 months ago, created a comment with at least 3 up-votes. For C: 200Bp Long Query Returning 201Bp
Teacher 5 months ago, created an answer with at least 3 up-votes. For A: biopython pairwise2 result to a file
Scholar 5 months ago, created an answer that has been accepted. For A: biopython pairwise2 result to a file

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 993 users visited in the last hour