User: Barry Digby

gravatar for Barry Digby
Barry Digby630
Reputation:
630
Status:
Trusted
Location:
National University of Ireland, Galway
Twitter:
@BarryDigby
Last seen:
an hour ago
Joined:
2 years, 7 months ago
Email:
b********@hotmail.com

PhD candidate @NUIG

Posts by Barry Digby

<prev • 107 results • page 1 of 11 • next >
0
votes
1
answer
156
views
1
answers
Comment: C: Which adapters to use for trimming?
... good spot, hasn't been updated since 2016! ...
written 2 days ago by Barry Digby630
0
votes
1
answer
156
views
1
answers
Comment: C: Which adapters to use for trimming?
... The guide fails to mention the resources directory is on github which from experience, took a bit of extra digging around than was necessary. It's here: https://github.com/BioInfoTools/BBMap/blob/master/resources/adapters.fa ...
written 2 days ago by Barry Digby630
0
votes
1
answer
163
views
1
answers
Comment: C: How to remove X & Y chromosome genes from RNAseq data
... My bad, I'm used to biomaRt df's derived from count rownames. Feel free to change yours to an answer and ill remove mine. . ...
written 11 days ago by Barry Digby630
2
votes
1
answer
163
views
1
answers
Answer: A: How to remove X & Y chromosome genes from RNAseq data
... Yep you're pretty much there. Assuming `counts` is your counts matrix containing all samples, something to the effect of: ``` subset <- counts[which(rownames(counts) != biomart_list$Gene),] ``` edit: `!=` must be dataframes of equal length ...
written 14 days ago by Barry Digby630
1
vote
3
answers
1.7k
views
3
answers
Comment: C: How to plot GSEA result?
... Some chump deleted my github accounts. I only recovered my primary account so that workflow is no longer available. Follow this for `fgsea` - https://stephenturner.github.io/deseq-to-fgsea/#using_the_fgsea_package And this for `GSEA` - https://www.biostars.org/p/238541/ ...
written 24 days ago by Barry Digby630
0
votes
1
answer
150
views
1
answers
Comment: C: TCGA gene and mirna expression value
... If you edit it accordingly, yes. ...
written 24 days ago by Barry Digby630
0
votes
0
answers
148
views
0
answers
Comment: C: Why is mapper.pl from mirdeep2 producing an empty mapping file?
... Try combining command 1 and 3, run command 2 first: bowtie-build genome/GRCh38.fa GRCh38_idx mapper.pl ../RawData.fq -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p GRCh38_idx -s reads_collapsed.fa -t reads_vs_genome.arf -v Does bowtie make correct indices from a fa.gz file? Maybe y ...
written 5 weeks ago by Barry Digby630
1
vote
1
answer
150
views
1
answers
Answer: A: TCGA gene and mirna expression value
... This gets asked a lot. Should probably make a tutorial.. Switch `TCGA-PRAD` to `TCGA-BRCA` and don't blindly run the metadata section. --- title: "TCGA_analysis" author: "Barry" date: "07/07/2020" output: html_document --- ```{r setup, include=FALSE} knitr::o ...
written 7 weeks ago by Barry Digby630
2
votes
3
answers
186
views
3
answers
Answer: A: Help interpretating DESeq2 output
... If you want to control for the effect of Replicates, shouldn't the design be `~ replicate + condition`? I am basing this on the following [workflow][1] from Mike Love et al. > The simplest design formula for differential expression would be `~ > condition`, where condition is a column in co ...
written 8 weeks ago by Barry Digby630
3
votes
1
answer
191
views
1
answers
Answer: C: HT-Seq count data coding gene
... This is what Hamid Ghaedi is referring to: ## filter for protein coding genes in matrix (currently > 50,000 rows) mart <- useMart(biomart = "ensembl", dataset = "hsapiens_gene_ensembl") mrna_attributes <- getBM(attributes=c("external_gene_name", ...
written 10 weeks ago by Barry Digby630

Latest awards to Barry Digby

Teacher 24 days ago, created an answer with at least 3 up-votes. For A: mireap procedure short tutorial
Teacher 5 weeks ago, created an answer with at least 3 up-votes. For A: mireap procedure short tutorial
Popular Question 10 weeks ago, created a question with more than 1,000 views. For GATK Panel Of Normals (PoN)
Teacher 10 weeks ago, created an answer with at least 3 up-votes. For A: mireap procedure short tutorial
Centurion 10 weeks ago, created 100 posts.
Scholar 11 weeks ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Scholar 3 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Scholar 3 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Voter 3 months ago, voted more than 100 times.
Popular Question 7 months ago, created a question with more than 1,000 views. For Tximport > DESeq2 (sample names)
Scholar 7 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Popular Question 9 months ago, created a question with more than 1,000 views. For Tximport > DESeq2 (sample names)
Student 10 months ago, asked a question with at least 3 up-votes. For Counting Gene Clusters from Antismash Output
Popular Question 12 months ago, created a question with more than 1,000 views. For GATK Panel Of Normals (PoN)
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: mireap procedure short tutorial
Popular Question 14 months ago, created a question with more than 1,000 views. For GATK Panel Of Normals (PoN)
Supporter 16 months ago, voted at least 25 times.
Appreciated 16 months ago, created a post with more than 5 votes. For A: mireap procedure short tutorial
Scholar 17 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Teacher 21 months ago, created an answer with at least 3 up-votes. For A: mireap procedure short tutorial
Scholar 21 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Scholar 2.1 years ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Scholar 2.2 years ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Autobiographer 2.6 years ago, has more than 80 characters in the information field of the user's profile.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2608 users visited in the last hour
_