User: Barry Digby

gravatar for Barry Digby
Barry Digby420
Reputation:
420
Status:
Trusted
Location:
National University of Ireland, Galway
Twitter:
@BarryDigby
Last seen:
10 hours ago
Joined:
2 years, 2 months ago
Email:
b********@hotmail.com

Currently attempting to get to the bottom of how circRNA - miRNA interactions are predicted and more importantly, ranked. 

Posts by Barry Digby

<prev • 83 results • page 1 of 9 • next >
0
votes
1
answer
1.4k
views
1
answers
Comment: C: Specify output dir when downloading snpEff database?
... Perfect, thanks Pierre. Ran into the same problem using a container. `snpEff download GRCh37.75 -dataDir /data/snpEff` @abe add the `-dataDir` flag . . . ...
written 2 days ago by Barry Digby420
0
votes
4
answers
197
views
4
answers
Answer: A: RNA seq data analysis
... This video should be what you want: [#16 Lockdown Learning Bioinformatics-along: Downloading from the SRA][1] [1]: https://www.youtube.com/watch?v=RSPaaSfA8DI ...
written 23 days ago by Barry Digby420
1
vote
2
answers
2.4k
views
2
answers
Comment: C: How to prepare .gct file for GSEA software?
... When saving the normalized counts in R set `quote = FALSE` . Or just remove them using sed `sed 's/"//g' your_file.gct > no_quotes.gct` ...
written 25 days ago by Barry Digby420
1
vote
1
answer
590
views
1
answers
Comment: C: How to deal with the abnormal samples from TCGA found in a PCA?
... Hi Kevin, I wanted to add on a quick side question to this thread (I don't think it warrants a new post, still discussing sample variation present in TCGA-PRAD DE analysis) When creating the design for DESeq2, the simplest way to do it is `design = ~ Condition` where condition has tumor/normal in ...
written 5 weeks ago by Barry Digby420
0
votes
2
answers
207
views
2
answers
Comment: C: Nextflow using existing Conda Environments
... Hi Bruce, I've had a spot of bother making the image. I have replaced the `%post` with my github repo but `singularity build` returns `ERROR: 'Bootstrap' type not supported: library`. I also went to the [page][1] where the container is hosted and tried to install via `singularity pull`, but it ret ...
written 6 weeks ago by Barry Digby420
0
votes
2
answers
207
views
2
answers
Comment: C: Nextflow using existing Conda Environments
... Hi Bruce, Yep, I derived the local solution (answer below) from a suggestion on the github page linked. Cool, I did not know you could create a container from a `.yml` file, could you share the singularity call used to build the container? I am keen on making this pipeline reproducible , +1 for po ...
written 7 weeks ago by Barry Digby420
0
votes
3
answers
131
views
3
answers
Comment: C: miRDeep2 problem with reads_collapsed.fa
... It worked? great! So the solution was to remake the `arf` file? ...
written 7 weeks ago by Barry Digby420
0
votes
3
answers
131
views
3
answers
Comment: C: miRDeep2 problem with reads_collapsed.fa
... sorry, I must have had it confused with mireap. are you sure the sequence lengths are all above 17? you might have to dig deeper into that. awk '/^>/{if (l!="") print l; print; l=0; next}{l+=length($0)}END{print l}' test.fa > lenghts.txt and parse output ...
written 8 weeks ago by Barry Digby420
0
votes
3
answers
131
views
3
answers
Answer: A: miRDeep2 problem with reads_collapsed.fa
... Take a look at this tutorial https://www.biostars.org/p/213088/#373944 You will need to split the fasta headers so that the collapsed read counts have a space separating the ID and count using `sed` >seq_1_x1 CTTATAGTGTAAGGTGGAATGAAG to >seq_1_x 1 CTTATAGTGTAAGGTGGAATGAAG ...
written 8 weeks ago by Barry Digby420
1
vote
2
answers
207
views
2
answers
Comment: C: Nextflow using existing Conda Environments
... I see, I'm a fan of using source /home/Anaconda3/4.4.0/etc/profile.d/conda.sh conda activate env-name Many ways to die in the west as my sys admin says! The `PATH` method is for nextflow specifically :) ...
written 8 weeks ago by Barry Digby420

Latest awards to Barry Digby

Popular Question 7 weeks ago, created a question with more than 1,000 views. For Tximport > DESeq2 (sample names)
Scholar 8 weeks ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Popular Question 3 months ago, created a question with more than 1,000 views. For Tximport > DESeq2 (sample names)
Student 5 months ago, asked a question with at least 3 up-votes. For Counting Gene Clusters from Antismash Output
Popular Question 7 months ago, created a question with more than 1,000 views. For GATK Panel Of Normals (PoN)
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: mireap procedure short tutorial
Popular Question 9 months ago, created a question with more than 1,000 views. For GATK Panel Of Normals (PoN)
Supporter 10 months ago, voted at least 25 times.
Appreciated 10 months ago, created a post with more than 5 votes. For A: mireap procedure short tutorial
Scholar 12 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: mireap procedure short tutorial
Scholar 16 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Scholar 20 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Scholar 21 months ago, created an answer that has been accepted. For A: Can I get AddOrReplaceReadGroups working for multiple files?
Autobiographer 2.2 years ago, has more than 80 characters in the information field of the user's profile.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 682 users visited in the last hour