User: sunnykevin97

gravatar for sunnykevin97
Reputation:
0
Status:
New User
Last seen:
3 weeks, 5 days ago
Joined:
3 months, 2 weeks ago
Email:
s***********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by sunnykevin97

<prev • 14 results • page 1 of 2 • next >
2
votes
1
answer
128
views
1
answer
picard CollectInsertSizeMetrics error
... Hi, why Im getting the error message using picard insert-metrics only on some bam files ? **Error** xception in thread "main" htsjdk.samtools.SAMFormatException: **SAM validation error: WARNING: Read name D00360:95:H2YWMBCXX:1:2113:8832:19449, No M or N operator between pair of D operators ...
genome assembly alignment written 5 weeks ago by sunnykevin970 • updated 21 days ago by Biostar ♦♦ 20
0
votes
0
answers
128
views
0
answers
parliament2 structural variant caller error
... After pulling the docker image not able to run parliament2, facing an import error how to sort out ? **(ImportError: cannot import name _remove_dead_weakref)** **docker run dnanexus/parliament2:hgsc -h** Traceback (most recent call last): File "/home/dnanexus/parliament2.py", line 3, in import ar ...
software error alignment snp written 5 weeks ago by sunnykevin970
0
votes
0
answers
160
views
0
answers
Comment: C: Indelrealignment step is require further processing the bam file ?
... thanks! If I'm during variant calling using Freebayes, strelka2 and other variant callers then Indel realignment is not necessary step ? ...
written 5 weeks ago by sunnykevin970
0
votes
0
answers
160
views
0
answers
Comment: C: Indelrealignment step is require further processing the bam file ?
... I'm looking for Mills_and_1000G_gold_standard.indels.hg38.vcf ? ...
written 5 weeks ago by sunnykevin970
0
votes
0
answers
160
views
0
answers
Comment: C: Indelrealignment step is require further processing the bam file ?
... How can i get known indel_calls.vcf to perform Indelrealigner step for bam files ? **-known /path/to/indel_calls.vcf** ...
written 5 weeks ago by sunnykevin970
1
vote
0
answers
160
views
0
answers
Indelrealignment step is require further processing the bam file ?
... Hi If I'm using GATK4.0, Indelrealignment step is required to process the bam ? ...
genome alignm snp written 5 weeks ago by sunnykevin970
0
votes
1
answer
190
views
1
answers
Comment: C: How to rectify error while sorting the sam file
... I tried showing truncated sam file **sed -i '10363596d' SRR.sam** > samtools view -u SRR.sam | samtools sort -@ 10 -T test/SRR.sort -o > SRR.bam [W::sam_read1] Parse error at line 10363596 [main_samview] truncated file. [bam_sort_core] merging from 0 files and 10 in-memory blocks... Gener ...
written 6 weeks ago by sunnykevin970
0
votes
1
answer
190
views
1
answers
Comment: C: How to rectify error while sorting the sam file
... > sed -n '10363595,10363597p;10363598q' SRR.sam SRR.5228479 99 chr6 65895862 3 250M = 65896126 513 TGGCCAATATGAAGGAGCTACTGGCTTCATGAAATTCCAAAATCCAGTGGGTCAGCAATTAAATCTTAAAGCTCCAAAATGACCTCCTTTGATTCCATGTCTCACACTTAGGCATGCTGATACAAGGGGTGGGCTCCCAAGGACTTGGGCAGCTCTGCCTCTGTGGCTCTTCAGGGTACATACCCCATGACTG ...
written 6 weeks ago by sunnykevin970 • updated 6 weeks ago by genomax58k
0
votes
1
answer
190
views
1
answers
Comment: C: How to rectify error while sorting the sam file
... I tried with samtools v.1.9 SRR.sam => 47 GB samtools view -bS SRR.sam > SRR.bam [W::sam_read1] Parse error at line 10363596 [main_samview] truncated file. SRR.bam => 1.9 GB samtools quickcheck -v -v -v -v SRR.bam && echo 'all ok' verbosity set to 4 ...
written 6 weeks ago by sunnykevin970 • updated 6 weeks ago by Vijay Lakhujani3.2k
0
votes
1
answer
190
views
1
answers
Comment: A: How to rectify error while sorting the sam file
... **samtools view -bS SRR1.sam > SRR1.bam** [W::sam_read1] Parse error at line 10363596 [main_samview] truncated file. SRR1.sam => 47 GB SRR1.bam => 1.9 GB samtools quickcheck -v -v -v -v SRR1.bam && echo 'all ok' verbosity set to 4 checking SRR1.bam ...
written 6 weeks ago by sunnykevin970 • updated 6 weeks ago by Vijay Lakhujani3.2k

Latest awards to sunnykevin97

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1716 users visited in the last hour