User: sunnykevin97

gravatar for sunnykevin97
sunnykevin9710
Reputation:
10
Status:
New User
Location:
Last seen:
3 hours ago
Joined:
5 months, 3 weeks ago
Email:
s***********@gmail.com

Posts by sunnykevin97

<prev • 48 results • page 1 of 5 • next >
0
votes
0
answers
85
views
0
answers
How to perform Null and Alternative models using PAML (estimation of dN/dS) ?
... Hi I runned PAML with example dataset , to estimate the dN/dS ratio It generate some output not to able interpret the results ? Is it possible to run PAML using null and alternative models ? If so, what the options do I need to add ? Here is codeml.ctl file seqfile = sample.nuc * ...
alignment sequence snp written 1 day ago by sunnykevin9710
0
votes
0
answers
67
views
0
answers
Comment: C: how to convert a fasta file to a PAML input file (nuc format) ?
... From aligned bam files, I called variants. Based on the reference genome annotation for each genome I modified the fasta sequences and generated CDS for all genomes (~18) what would be the next step ? ...
written 4 days ago by sunnykevin9710
0
votes
0
answers
67
views
0
answers
how to convert a fasta file to a PAML input file (nuc format) ?
... Hi I have CDS sequences for the genome datasets. How to convert **fasta to a .nuc format** file (used for a running PAML) ? fasta format >chr9:94400443-94400608 CTGCTGCCCCACTTGATGCCCAGCTCCTGGCCATAGTTGTCCCCATACGAGACCAGCAGCTCACAGCCAGGCTGGATGGTGCGGCAAGTCCAGTAGAAGATCTGCCTGTGGTACTGAAAGG ...
alignment snp written 5 days ago by sunnykevin9710
0
votes
0
answers
119
views
0
answers
Comment: C: Multiple sequence alignment tools for bigdata genomics ?
... thanks, genome size ~ 8 GB each mostly all are draft genomes. ...
written 5 days ago by sunnykevin9710
0
votes
1
answer
90
views
1
answers
Comment: C: Running PAML without Tree file?
... Thanks, for suggestions. I'll try. ...
written 5 days ago by sunnykevin9710
0
votes
0
answers
119
views
0
answers
Multiple sequence alignment tools for bigdata genomics ?
... HI I'm looking for alignment tools which do multiple genome alignments and can able to handle big size WGS data ? I had a job to do, In one go I'd like to align ~18 WGS datsets ? If their any tools, can it generates MSA alignment in PHYLIP format or other format ? suggestions please... ...
genome alignment written 5 days ago by sunnykevin9710
0
votes
1
answer
90
views
1
answers
Comment: C: Running PAML without Tree file?
... Well, LASTZ is for pairwise comparison. But, I interested in multiple genome alignment ? My genome's are too big. suggestions please. thanks! ...
written 5 days ago by sunnykevin9710
0
votes
1
answer
90
views
1
answers
Comment: C: Running PAML with out Tree file?
... Thanks, totally I have 18 genome data-sets to estimate the dN/dS using PAML. Firstly, I'll align all the genomes using CLUSTAL and I'll generate a MSA file in phylip format (any good tools which handle big data-sets) ? But, how I'll generate a tree file to run PAML ? any tools ? data-sets are more ...
written 5 days ago by sunnykevin9710
3
votes
1
answer
90
views
1
answer
Running PAML without Tree file?
... Hi After exploring little bit about PAML for calculating dN/dS rate two files are required, as an input codeml.ctl file 1) MSA in phylip format 2) Tree file. My question is, already I know the phylogeny of my genome data. I'm interested in calculating only dN/dS rate among the each genome. How I ...
sequence alignment written 6 days ago by sunnykevin9710 • updated 5 days ago by jrj.healey10.0k
0
votes
0
answers
112
views
0
answers
Comment: C: vcf tools (vcf-stats) not able to generate stats ?
... Looking for SNP and INDEL count. ...
written 11 days ago by sunnykevin9710

Latest awards to sunnykevin97

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1915 users visited in the last hour