User: avelarbio46

gravatar for avelarbio46
avelarbio4610
Reputation:
10
Status:
New User
Location:
Last seen:
42 minutes ago
Joined:
2 years, 5 months ago
Email:
a**********@gmail.com

Posts by avelarbio46

<prev • 20 results • page 1 of 2 • next >
0
votes
1
answer
7.6k
views
1
answers
Comment: C: GO analysis using topGO
... > goEnrichment$KS <- as.numeric(goEnrichment$KS) should come before filtering KS! ...
written 1 hour ago by avelarbio4610
2
votes
1
answer
94
views
1
answer
Gene size correction for small RNA
... Hello everyone! I have a question about gene size normalization. Usually, when comparing intra-sample gene expression, we need to normalize intra-sample variation. The most common method is gene lenght correction, because longer genes will have more reads. But I'm analyzing small RNA sequencing ( ...
normalization small rna rna-seq mirna written 3 days ago by avelarbio4610 • updated 3 days ago by dsull1.8k
2
votes
2
answers
74
views
2
answers
How to trim reads when I'm not sure where they are?
... Hello everyone! We did a RNAseq paired end with 150 bp in NovaSeq with TruSeq Total RNA strandred, with an external supplier. I'm now trying to analyze the data but I'm having trouble with the adaptors They sent me the following sequences: " P7: GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCAGATTATCTCGTAT ...
illumina rna-seq cutadapt written 10 days ago by avelarbio4610 • updated 10 days ago by shelkmike320
1
vote
3
answers
211
views
3
answers
Comment: C: Best ubuntu version for bioinformatics?
... Well, I'm a newbie, so take this with a grain of salt: I tried using a program named RNAeditor in Ubuntu 18.04. This is an ~old~ program, and the GUI was created using PYqt4 web kit. This function was deprecated in python3, so I manually installed SIP and PYQT4 packages with web kit in a virtual ...
written 5 weeks ago by avelarbio4610
24
votes
3
answers
211
views
7 follow
3
answers
Best ubuntu version for bioinformatics?
... Hello everyone! We bought a new server to analyze our data, but our infrastructure is small. I was wondering, what version of ubuntu is the best for bioinformatics? I had a lot of problems with 18.04 because many packages were broken, and when I search for ubuntu 20.04, I see that people are not ...
ubuntu written 5 weeks ago by avelarbio4610 • updated 5 weeks ago by Mensur Dlakic8.3k
0
votes
2
answers
187
views
2
answers
Comment: C: Small RNAseq Dataset to test scripts
... I'm using STAR and STAR fusion. Last time we tried, we got memory error, but worked in 64gb machine. ...
written 5 weeks ago by avelarbio4610
0
votes
2
answers
187
views
2
answers
Comment: C: Small RNAseq Dataset to test scripts
... I really need to use STAR. We decided that it is the best aligner for our needs, and we can also use RNA-star fusion. We tried to create the index and with 32 gb RAM we got no memory error! The problem with using the indexed reference is that sometimes it is hard to download, after two or three yea ...
written 5 weeks ago by avelarbio4610
0
votes
2
answers
187
views
2
answers
Comment: C: Small RNAseq Dataset to test scripts
... Please put this as an answer! I calculated and it seems like it will be plausible to do everything I need with the S. cerevisiae RNA-seq datasets. They are small enough that I can create indexes and align fast, but also it is highly studied which gives rise to many acessible datasets and references. ...
written 5 weeks ago by avelarbio4610
0
votes
2
answers
187
views
2
answers
Comment: C: Small RNAseq Dataset to test scripts
... I'm sure this might work, but there is a big problem: I can't subsample the reference. For RNA-star, the hg38 reference wants 64gb of memory to create the index, which is prohibitive for my system! ...
written 5 weeks ago by avelarbio4610
3
votes
2
answers
187
views
2
answers
Small RNAseq Dataset to test scripts
... Hello everyone! I will be processing a big amount of RNAseq data in the next months, but we do not have a server yet (it will arrive next march). In the mean time, I have a small PC with 16gb ram. I would like to test my scripts (cutadapt, RNA-Star, STAR-fusion, htseq, deseq2 etc). This means that ...
rna-seq written 6 weeks ago by avelarbio4610 • updated 6 weeks ago by Qiongyi100

Latest awards to avelarbio46

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1544 users visited in the last hour
_