User: westin.kosater

Reputation:
10
Status:
New User
Location:
Last seen:
1 week ago
Joined:
3 months, 2 weeks ago
Email:
w*************@gmail.com

Posts by westin.kosater

<prev • 13 results • page 1 of 2 • next >
0
votes
1
answer
83
views
1
answer
Make a multiple sequence alignment with a HMMER hmmsearch output?
... I have a database of protein sequences and I just did a search (hmmsearch) through the database against my hmmfile using HMMER for all sequence with an E value cutoff. I saved my output from that to a text file, but now I want to do a multiple sequence alignment with the sequences from hmmsearch and ...
hmmer written 9 days ago by westin.kosater10 • updated 8 days ago by h.mon23k
1
vote
0
answers
77
views
0
answers
Trying to interpret the content of a hmm file from HMMER3
... I am working on a homework assignment for a course I am taking. One of the question I am struggling to figure out for myself. What I have done so far is built a HMM model from a sequence with hmmbuild. Here is a short section of that hmmfile as viewed in my text editor HMMER3/f [3.2.1 | June ...
hmmer written 12 days ago by westin.kosater10
1
vote
1
answer
60
views
1
answer
Python: I have a list of probabilities, and I want to use them to generate mutations in a protein sequence
... I have a list of probabilities that I have generated. Here is a short snippet of what this variable looks like [0.62, 0.20. 0.0, 0.69, 0.24, 0.50, ...] These are probabilities that an amino acid substitution will happen in a protein sequence. What I want to do is to take this list of probabili ...
pdb python dssp written 12 days ago by westin.kosater10 • updated 12 days ago by e.benn60
0
votes
2
answers
138
views
2
answers
List of sequences in a fasta file. I need to generate the reverse complement for each of them.
... Here is what the list of sequences looks like in the file `brca.example.illumina.0.1.fasta` >Frag_1 chr17 (Strand + Offset 106709--107175) 467M 101M AGGCAGGTCTCAAACTCCTGACCTCAGGTGATCCACCCACCTCAAGCCTCCCAAAGTGCT GGGATTATAGGCATGAGCCACCATGTCCGGCAAGTTTCTTT >Frag_2 chr17 (Strand + O ...
python biopython written 29 days ago by westin.kosater10 • updated 28 days ago by JC7.4k
0
votes
0
answers
147
views
0
answers
Getting an error whilst trying to import Biopython SeqIO
... I wrote one line of my program from Bio import SeqIO And when I compile, the interpreter outputs the following error ImportError: cannot import name '_aligners' I've never had this problem before. Does anyone know what could possibly be wrong? ...
python biopython written 29 days ago by westin.kosater10
3
votes
1
answer
160
views
1
answer
Putting atomic coordinates from PDB file into Pandas dataframe?
... Greetings all. I have a list of atomic coordinates from a PDB file saved to variable x. This is a short sample of what I get in the interpreter when I write `print(x)` in my code [22.732 33.537 34.278] [20.362 36.096 32.786] [20.421 34.188 29.509] [18.039 31.768 31.227] [16.639 ...
pdb python pandas written 11 weeks ago by westin.kosater10 • updated 11 weeks ago by RamRS20k
0
votes
1
answer
331
views
1
answers
Comment: C: Creating a distance matrix from PDB file coordinates (Python)
... Thank you for the explanation. For the record, I was looking for a method to do all vs. all ...
written 11 weeks ago by westin.kosater10
3
votes
1
answer
331
views
1
answer
Creating a distance matrix from PDB file coordinates (Python)
... Hello all I have a list of xyz coordinates of different points from a PDB file assigned to variable x. Here is a snippet of what it looks like [ 8.721 15.393 22.939] [11.2 13.355 25.025] [11.045 15.057 28.419] [13.356 13.814 31.169] [12.54 13.525 34.854] [14.038 15.691 3 ...
pdb python written 12 weeks ago by westin.kosater10 • updated 11 weeks ago by jrj.healey10k
0
votes
1
answer
342
views
1
answers
Comment: C: How do I download and install DSSP?
... Thank you. As a follow up question., how can I make sure that the dssp binary is in $PATH? ...
written 3 months ago by westin.kosater10
2
votes
1
answer
342
views
1
answer
How do I download and install DSSP?
... I am looking through the Biopython Tutorial and Cookbook (http://biopython.org/DIST/docs/tutorial/Tutorial.html) and in order to look at DSSP files with biopython, I need to obtain a copy and license of DSSP from this link (https://swift.cmbi.umcn.nl/gv/dssp/). Could somebody please explain how I ta ...
python biopython dssp written 3 months ago by westin.kosater10 • updated 3 months ago by jrj.healey10k

Latest awards to westin.kosater

No awards yet. Soon to come :-)

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1795 users visited in the last hour