User: newbie

gravatar for newbie
newbie70
Reputation:
70
Status:
Trusted
Location:
Last seen:
2 hours ago
Joined:
1 year, 5 months ago
Email:
m******************@gmail.com

Posts by newbie

<prev • 84 results • page 1 of 9 • next >
0
votes
1
answer
41
views
1
answer
How to check whether mutation in a gene activating or inactivating other genes?
... I have mutational data and created an oncoplot that shows the number of mutations and the type of mutation of genes in each sample. Showing here an example plot: ![enter image description here][1] How can I look whether DNMT3A gene mutation activating or inactivating other genes? [1]: https: ...
wgs maftools activation mutation written 1 day ago by newbie70 • updated 1 day ago by JC11k
0
votes
1
answer
63
views
1
answers
Comment: C: Error with Rseqc infer_experiment - unknown datatype
... okay. you mean in the above bam it is seen that `XS:A` is given `-` so this tells the data is strand specific? Am I right? and how based on genes we can say that? ...
written 2 days ago by newbie70
0
votes
1
answer
63
views
1
answers
Comment: C: Error with Rseqc infer_experiment - unknown datatype
... This is PairEnd Data Fraction of reads failed to determine: 0.0000 Fraction of reads explained by "1++,1--,2+-,2-+": 0.0047 Fraction of reads explained by "1+-,1-+,2++,2--": 0.9953 As "1+-,1-+,2++,2--" gets more signal which means fr-firststrand. So, in HISAT2 alignment step the –rna –stra ...
written 2 days ago by newbie70 • updated 2 days ago by genomax87k
0
votes
1
answer
63
views
1
answers
Comment: C: Error with Rseqc infer_experiment - unknown datatype
... can you please help me with this...for my previous comment. ...
written 2 days ago by newbie70
0
votes
1
answer
63
views
1
answers
Comment: C: Error with Rseqc infer_experiment - unknown datatype
... My bam file looks like this: D00535:34:CBMGRANXX:6:2205:6601:17310 355 1 15311 1 92M = 15443 230 CTGGGGTCACAGAGCAAGGCAAAAGCAGCGCTGGGTACAAGCTCAAAACCATAGTGCCCAGGGCACTGCCGCTGCAGGCGCAGGCATCGCATGGGGEGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGG AS:i:0 Z ...
written 2 days ago by newbie70
0
votes
1
answer
63
views
1
answers
Answer: C: Error with Rseqc infer_experiment - unknown datatype
... okay I found the solution. The problem is with `chr` In the bam file it is only number. So, now I removed `chr` in gtf and converted to bed and used rseqc and got the output without any error. ...
written 2 days ago by newbie70
0
votes
1
answer
63
views
1
answers
Comment: C: Error with Rseqc infer_experiment - unknown datatype
... gencode.v27.annotation.bed looks like this: chr1 11868 12227 ENSG00000223972.5 . + HAVANA exon . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX1 ...
written 2 days ago by newbie70
0
votes
1
answer
63
views
1
answer
Error with Rseqc infer_experiment - unknown datatype
... I'm using rseqc on my samples bam file to check the strand specific. For this I used gencode gtf file. Initially I converted gencode gtf to bed file like: This is how the gtf looks: ##description: evidence-based annotation of the human genome (GRCh38), version 27 (Ensembl 90) ##provider: ...
rseqc inferexperiment rna-seq gtf2bed written 2 days ago by newbie70
0
votes
1
answer
145
views
1
answers
Comment: C: How to look for a specific nucleotides of lncRNA sequence in TCGA data?
... @Kevin Blighe and @genomax based on coordinates of the novel lncRNA sequence, I extracted the given region from on TCGA sample bam and visualized in IGV and I see that the lncRNA sequence aligns with the exon of a coding gene TNC. How do I proceed now? ...
written 10 days ago by newbie70
0
votes
1
answer
145
views
1
answers
Comment: C: How to look for a specific nucleotides of lncRNA sequence in TCGA data?
... Thanks a lot will try this approach first but do you think first I should visualise in IGV to see whether there is a possibility for expression? ...
written 11 days ago by newbie70

Latest awards to newbie

Supporter 12 weeks ago, voted at least 25 times.
Popular Question 4 months ago, created a question with more than 1,000 views. For How to filter low expressed genes based on TPM expression?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 725 users visited in the last hour