User: 9521ljh

gravatar for 9521ljh
9521ljh10
Reputation:
10
Status:
New User
Location:
Last seen:
17 hours ago
Joined:
3 months ago
Email:
9******@gmail.com

Posts by 9521ljh

<prev • 20 results • page 1 of 2 • next >
0
votes
1
answer
68
views
1
answer
ABSOLUTE output interpretation
... i have two bam file (normal.bam and tumor.bam ) i run CNVkit(tool) to find out copy number. After i ran i have get to know tumor purity and ploidy are important factor to uncover Copy number. Thus, i find the tool for identify purity and ploidy, "ABSOLUTE", and ran it. But i can't find the docume ...
scna absolute purity ploidy written 9 days ago by 9521ljh10 • updated 9 days ago by Kevin Blighe42k
0
votes
4
answers
195
views
4
answers
Comment: C: very confused with GC bias
... it is raw fastq file. ...
written 16 days ago by 9521ljh10
10
votes
4
answers
195
views
7 follow
4
answers
very confused with GC bias
... I have fastq files and find `Per sequence GC content` is not well shaped. Therefore I think it is contaminated. ![enter image description here][1] But is this failure of GC content means GC bias? Because I think GC bias is related with coverage and depth of read (after mapping problem) but ...
fastqc written 16 days ago by 9521ljh10 • updated 10 days ago by chen1.9k
3
votes
1
answer
102
views
1
answer
is there any other value for evaluating Sequence Mapping??
... I only find MappingQuality value. is there no other value to evaluate how well seqeunces are mapped? i want to know what kinds of measurement do we need to conclude mapping is Good. ...
assembly alignment sequencing written 20 days ago by 9521ljh10 • updated 20 days ago by Fabio Marroni2.2k
4
votes
1
answer
129
views
1
answer
is there exist GATK pre-processing(WGS) Script??
... i have so confused because of different version. So i want to find Script of pre-processing for whole genome seqeuncing result from GATK ...
genome alignment sequence sequencing written 23 days ago by 9521ljh10
4
votes
2
answers
93
views
2
answers
Interpretation Fastq file format (paired end)
... I download SRR5376997.sra from NCBI and i convert SRA to fastq using SRA toolkit fastq-dump SRR5376997.sra output: SRR5376997.fastq head SRR5376997.fastq @SRR5376997.1 HWI-ST1215:350:C42MLACXX:8:1101:1631:2122 length=202 TGTTAAATGATCTAATGAAAAAGATAAACAATTACATAAACAGATGGGGAATTTCAGAGAACTAAA ...
sequence alignment sequencing written 24 days ago by 9521ljh10 • updated 24 days ago by Bastien Hervé4.2k
1
vote
0
answers
91
views
0
answers
How to split Fastq file into Forward, reverse fastq file.
... Hi. i have SRR0000.sra file. and i have SRR0000.fastq using SRA toolkit. then i want to split it forward fastq and reverse fastq. how to???? i try to use SRA toolkit - fastq-dump -I --split-files SRR0000.sra but the output is just the half of file. i don't think it is right for forward and rev ...
gene genome sequence sequencing written 24 days ago by 9521ljh10
3
votes
0
answers
111
views
0
answers
NCBI location name
... I find somatic mutation one of the genes is APH1A But there are not one annotation. ex. APH1A:NM_001077628:exon4:c.T425A:p.L142H APH1A:NM_016022:exon4:c.T425A:p.L142H APH1A:NM_001243771:exon3:c.T254A:p.L85H APH1A:NM_001243772:exon3:c.T215A:p.L72H Question: 1. Wha ...
genome gene sequence snp sequencing written 29 days ago by 9521ljh10 • updated 29 days ago by zx87547.3k
3
votes
1
answer
90
views
1
answer
Get rid of Low Quality Bases In A Sequence, and which be replaced on removed place?
... if we remove low quality base on read by programming, for example ''sickle'', then what is be replaced on there? if we put the null value 'N' on there, i think it make big problem for mapping. For example, we have sequence ATCGACTAGAT**A**CCCGTT (bold meaning low quality) and we remove it ...
sequence rna-seq snp sequencing written 4 weeks ago by 9521ljh10 • updated 4 weeks ago by WouterDeCoster39k
0
votes
0
answers
144
views
0
answers
Comment: C: how to extract only exon from copynumber called by Varscan2?
... oh sorry, i post my result of CBS by DNAcopy! ...
written 5 weeks ago by 9521ljh10

Latest awards to 9521ljh

Supporter 12 days ago, voted at least 25 times.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1582 users visited in the last hour