User: amitpande74

gravatar for amitpande74
amitpande7410
Reputation:
10
Status:
New User
Location:
Last seen:
13 hours ago
Joined:
8 years, 7 months ago
Email:
a**********@gmail.com

about me

Posts by amitpande74

<prev • 45 results • page 1 of 5 • next >
2
votes
3
answers
76
views
3
answers
Read detection with pattern in paired end FASTQ file
... HI, I have paired end reads, and want to extract reads which have the insert `TGTATGTAAACTTCCGACTTCAACTGTA`in them. I tried with `grep -A2 -B1 "TGTATGTAAACTTCCGACTTCAACTGTA" input.fq |grep -v "^\-\-$"` > 1.fq and 2.fq But they dont align with Bowtie2 anymore, because the reads have differing head ...
fastq paired end awk written 11 days ago by amitpande7410 • updated 11 days ago by GenoMax95k
0
votes
0
answers
96
views
0
answers
Comment: C: complexheatMap runtime error
... Shall check if this is the case. ...
written 28 days ago by amitpande7410
1
vote
0
answers
96
views
0
answers
complexheatMap runtime error
... HI, I tried running heatmap from complexheatmap package. It gives an error: Listening on http://127.0.0.1:5089 Warning: Error in : Heatmap name cannot be empty string. 215: stop 214: stop_wrap 213: Heatmap 212: eventReactiveHandler [/home/amit/Downloads/Shiny-master/ ...
R complexheatmap written 28 days ago by amitpande7410
1
vote
1
answer
176
views
1
answers
Comment: C: bowtie2 shell script
... (base) usr@usr-X705UDR:/media/usr/Elements/usr$ ./bowtie.sh + MYPATH=/media/usr/Elements/usr/Extracted_SB_reads + find /media/usr/Elements/usr/Extracted_SB_reads -maxdepth 3 -type -f name '*.fq$' find: Unknown argument to -type: - Stops here. So corrected it to: #!/bin/bash - ...
written 5 weeks ago by amitpande7410
0
votes
1
answer
176
views
1
answers
Comment: C: bowtie2 shell script
... Hi, Thanks for your help. These fastq files are not very big, as only those reads which have the transposon and the guide RNA have been extracted (wgs). I tried running it script though, and it gave an error: (base) usr@usr-X705UDR:/media/usr/Elements/usr$ ./bowtie.sh + MYPATH=/media/usr/ ...
written 5 weeks ago by amitpande7410
0
votes
1
answer
176
views
1
answers
Comment: C: bowtie2 shell script
... These are reads extracted for a transposon and guideRNA. They have to be aligned to the human genome to determine the genomic location of their insertion. (base) amit@amit-X705UDR:/media/amit/Elements/usr/Extracted_SB_reads$ ls B2DNA_extractedSB DNA27.extractedSB DNA4.extractedSB H1DNA ...
written 5 weeks ago by amitpande7410
0
votes
1
answer
176
views
1
answers
Comment: C: bowtie2 shell script
... I did. for i in /media/usr/Elements/usr/Extracted_SB_reads/C1DNA.extrSB/*.fq do bowtie2 --sensitive-local -p8 -x /media/usr/Elements/usr/bowtie2_index/hg19/ -U ${i}.fq -S $i.sam done and now it says: (ERR): bowtie2-align exited with value 1 stat: Bad file descr ...
written 5 weeks ago by amitpande7410
6
votes
1
answer
176
views
1
answer
bowtie2 shell script
... Dear All, I have tons of folders inside which I have fastq files, and these are single end reads.![folders][1] ![files][2] I want to write a shell/bash script to automate the alignment. for i in /media/usr/Elements/name/Extracted_SB_reads/C1DNA.extrSB/*.fq do bowtie2 --sensitive ...
bowtie2 shellscript written 5 weeks ago by amitpande7410 • updated 5 weeks ago by ATpoint44k
0
votes
0
answers
139
views
0
answers
Comment: C: bowtie2 making new indices
... Primarily the genomic locations where the transposon has inserted ...
written 6 weeks ago by amitpande7410
0
votes
0
answers
139
views
0
answers
Comment: C: bowtie2 making new indices
... The transposon and the gDNA are seen in the SAM file, but downstream processing of the SAM file into BAM and BAM to BED does not result into the chromosome numbers. It looks like this chr 123 456 So while the reads are being retrieved in the SAM files, I cannot trace the genomic coordinates. ...
written 6 weeks ago by amitpande7410

Latest awards to amitpande74

Supporter 4 weeks ago, voted at least 25 times.
Popular Question 4 months ago, created a question with more than 1,000 views. For gene expression classification
Popular Question 7 months ago, created a question with more than 1,000 views. For gene expression classification
Popular Question 3.7 years ago, created a question with more than 1,000 views. For extracting reads from BAM files for gene coordinates Tx start Txs end

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1629 users visited in the last hour
_