User: amitpande74

gravatar for amitpande74
Reputation:
0
Status:
New User
Last seen:
2 days, 3 hours ago
Joined:
7 years, 3 months ago
Email:
a**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by amitpande74

<prev • 9 results • page 1 of 1 • next >
3
votes
1
answer
81
views
1
answer
extracting strand information from BAM to BED
... Hi everyone, I have used bedtools bamtobed to extract information. My file looks like this: chr10 1195932 1195977 NB551726:5:H2HT5BGXC:1:11101:11237:5492 41 + chr10 1195932 1195977 NB551726:5:H2HT5BGXC:1:11101:22230:17587 41 + I am loosing the strand information when I tried bedtools mer ...
bedtools bam files written 11 days ago by amitpande740 • updated 11 days ago by ATpoint23k
0
votes
1
answer
129
views
1
answers
Comment: A: grep DNA after a pattern
... @ lakhujanivijay yes ...
written 26 days ago by amitpande740
7
votes
1
answer
129
views
1
answer
grep DNA after a pattern
... HI, I have DNA sequences like these : ![](https://i.ibb.co/g3Vrjbm/seq.png) and I want to keep all sequences after this pattern "ACTTAAGTGTATGTAAACTTCCGACTTCAACTG" beginning with "TA". I tried grep -v "ACTTAAGTGTATGTAAACTTCCGACTTCAACTG" file.txt but it does not work. Kindly help. ...
dnaseq grep written 26 days ago by amitpande740 • updated 26 days ago by Benn7.7k
0
votes
1
answer
266
views
1
answer
chimeric transcripts detection tool
... Hi, I want to analyze RNAseq data for detecting Chimeric transcripts. Which tool would be best to use. I am aware of some from here [Nature][1]. Kindly help. thanks. [1]: https://www.nature.com/articles/srep21597 ...
rna-seq written 10 months ago by amitpande740 • updated 10 months ago by enxxx23230
0
votes
1
answer
551
views
1
answers
Comment: C: cutadapt error problem
... >barcode01 CGCAGG >barcode02 CTCTGCA >barcode03 CCTAGGT >barcode04 GGATCAA >barcode05 GCAAGAT >barcode06 ATGGAGA >barcode07 CTCGATG >barcode08 GCTCGAA ...
written 11 months ago by amitpande740 • updated 11 months ago by Devon Ryan92k
0
votes
1
answer
551
views
1
answers
Comment: A: cutadapt error problem
... Thanks for your replies.....kindly look [here]([https://cutadapt.readthedocs.io/en/stable/guide.html#named-adapters) I tried using it without cd but yet it complains about too many arguments. cutadapt -a TCGCAGGACC -a CTCTGCAACC -a CCTAGGTACC -a GGATCAAACC -a GCAAGATACC -a ATGGAGAACC -a CTCGA ...
written 11 months ago by amitpande740 • updated 11 months ago by Devon Ryan92k
1
vote
1
answer
551
views
1
answer
cutadapt error problem
... Hi, I am trying to use cutadapt installed from conda. I am running this command : cutadapt -a cd /media/moloy/LaCie/bburg/20180910_FMT-IBS-Exp1/unzipped/barcodes.fasta -o cd /media/moloy/LaCie/bburg/20180910_FMT-IBS-Exp1/output.fastq input cd /media/moloy/LaCie/bburg/20180910_FMT-IBS-Exp1/unz ...
software error next-gen written 11 months ago by amitpande740
1
vote
1
answer
827
views
1
answer
gene expression classification
... Hi, I have FPKM values for 1000 genes and would like the classify these based on FPKM values as high, medium and low expressed. Can someone kindly tell me how to do this using R. ...
rna-seq written 2.4 years ago by amitpande740 • updated 2.4 years ago by mmmmcandrew70
2
votes
3
answers
2.0k
views
3
answers
extracting reads from BAM files for gene coordinates Tx start Txs end
... Hi,       I have a list of Refseq annotated gene coordinates and I would like to extract the reads for the same in one go. I have read many posts here and at Seqanswers, but those are restricted to a particular region. for example samtools view input.bam "Chr10:18000-45500" > output.bam. How ca ...
samtools rna-seq written 4.5 years ago by amitpande740 • updated 4.5 years ago by Alex Reynolds28k

Latest awards to amitpande74

Popular Question 2.4 years ago, created a question with more than 1,000 views. For extracting reads from BAM files for gene coordinates Tx start Txs end

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 884 users visited in the last hour