User: amitpande74

gravatar for amitpande74
Reputation:
0
Status:
New User
Last seen:
6 days, 19 hours ago
Joined:
7 years, 9 months ago
Email:
a**********@gmail.com

Profile information, website and location are not shown for new users.

This helps us discourage the inappropriate use of our site.

Posts by amitpande74

<prev • 16 results • page 1 of 2 • next >
0
votes
0
answers
114
views
0
answers
Comment: C: bowtie2 aligment problems
... How should the command line be: ./bowtie rat/rn4 -s file.fastq test.sam or should the specific read be specified. I have never used this before so could you kindly help. ...
written 22 days ago by amitpande740
0
votes
0
answers
114
views
0
answers
Comment: C: bowtie2 aligment problems
... 43 base pairs after trimming. The entire read length before trimming is 75bps. ...
written 22 days ago by amitpande740
0
votes
0
answers
114
views
0
answers
Comment: A: bowtie2 aligment problems
... No the reads are single end. This is how the library was prepared. ...
written 22 days ago by amitpande740
0
votes
0
answers
114
views
0
answers
bowtie2 aligment problems
... Hi, I have reads from DNA sequencing,5 pools. The reads look like this: @NS500455:80:HG7TNBGXB:1:11101:17723:1055 1:N:0:ATCACG ACTTANGTGTATGTAAACTTCCGACTTCAACTGTATAGGGATCCNAGCTCCAATTCGCCCTATAGTGAGTCGTAT + /AAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE#EEEEEEEEEEEEEEEEEEEEEEEEEE ...
bowtie2 next-gen alignment written 23 days ago by amitpande740
1
vote
0
answers
103
views
0
answers
fetching fastq files for all samples
... Hi, I want to download all the files from this archive simultaneously: ftp://ftp.ddbj.nig.ac.jp/ddbj_database/dra/fastq/SRA166/SRA166615 How can I do this, is there wget command or anything else that might be helpful. regards, Amit. ...
fastq files written 11 weeks ago by amitpande740
0
votes
0
answers
109
views
0
answers
Chip exo data analysis
... Hi everyone, I have ChIP-exo data and I analyzed it both using MACS2 and GEM. The results differ a lot in terms of peaks, over-represented motifs and binding motifs. Kindly enlighten me as to which one is apt to use. regards. ...
chip exo macs2 gem written 5 months ago by amitpande740
0
votes
0
answers
149
views
0
answers
HMG box Chipseq
... Hi, I want to access HMG box TF ChIP seq data In ESC. Tried searching in ENCODE . They have HMG in HepG2 cells. Can anyone point to a resources please. Regards, Amit. ...
chip-seq written 6 months ago by amitpande740
3
votes
1
answer
196
views
1
answer
extracting strand information from BAM to BED
... Hi everyone, I have used bedtools bamtobed to extract information. My file looks like this: chr10 1195932 1195977 NB551726:5:H2HT5BGXC:1:11101:11237:5492 41 + chr10 1195932 1195977 NB551726:5:H2HT5BGXC:1:11101:22230:17587 41 + I am loosing the strand information when I tried bedtools mer ...
bedtools bam files written 7 months ago by amitpande740 • updated 7 months ago by ATpoint32k
0
votes
1
answer
258
views
1
answers
Comment: A: grep DNA after a pattern
... @ lakhujanivijay yes ...
written 7 months ago by amitpande740
7
votes
1
answer
258
views
1
answer
grep DNA after a pattern
... HI, I have DNA sequences like these : ![](https://i.ibb.co/g3Vrjbm/seq.png) and I want to keep all sequences after this pattern "ACTTAAGTGTATGTAAACTTCCGACTTCAACTG" beginning with "TA". I tried grep -v "ACTTAAGTGTATGTAAACTTCCGACTTCAACTG" file.txt but it does not work. Kindly help. ...
dnaseq grep written 7 months ago by amitpande740 • updated 7 months ago by Benn7.9k

Latest awards to amitpande74

Popular Question 2.9 years ago, created a question with more than 1,000 views. For extracting reads from BAM files for gene coordinates Tx start Txs end

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1630 users visited in the last hour