User: ancient_learner

gravatar for ancient_learner
Reputation:
630
Status:
Trusted
Location:
India
Last seen:
4 hours ago
Joined:
8 years, 2 months ago
Email:
a**********@gmail.com

I am a Bioinformatician dealing with NGS data analysis

Posts by ancient_learner

<prev • 142 results • page 1 of 15 • next >
0
votes
1
answer
117
views
1
answers
Answer: A: How to find if our enhancer gene pair fall within TAD
... Use Bedtools IntersectBed to see whether the positions of your enhancers overlap with TAD regions. ...
written 11 weeks ago by ancient_learner630
0
votes
0
answers
95
views
0
answers
Annotate the K-mers of same length with TFs
... Hi, Greetings! I have a list of K-mers (Human) like below AAGTGCG GGCGGCT ACGTGGCA TGCGTGGG TGGCGTGA Some of these K-mers may be serving as binding sites for TFs and some may be just the repeats. I want to annotate these K-mers with TFs. Wondering if there is a tool already whi ...
annotattion tf k-mers written 11 weeks ago by ancient_learner630 • updated 10 weeks ago by geek_y11k
0
votes
0
answers
184
views
0
answers
Comment: C: Choosing the cutoff for e-value when using very small Sequences
... As I told it's IGH locus and am looking at IGHD gene segments which are small ...
written 5 months ago by ancient_learner630
0
votes
0
answers
184
views
0
answers
Comment: C: Choosing the cutoff for e-value when using very small Sequences
... I think II should explain it better. I have a 400 bp sequence (which is a query in my case) like this >seq1 ATGGCGTGCGGTGCGTGCGTGCGGTGC**AGCGTGGCGT**ATGTGCGTGGCGT......... I have a reference file in which each entry would be close to 20 bp or even less >Dgene1 AGTGGGTGTGAGTG ...
written 5 months ago by ancient_learner630
3
votes
0
answers
184
views
0
answers
Choosing the cutoff for e-value when using very small Sequences
... Hi I hope you all are doing good. I am dealing with IGHD genes (Mouse genome) which are small in size. We have got our HTGTS-Seq done and have got the reads I want to particularly check for D segment in the IGH locus. So my reference file here is D gene segments file to which some of my reads shall ...
blastn evalue written 6 months ago by ancient_learner630
0
votes
0
answers
499
views
0
answers
Comment: C: Analysis pipeline for 3e Hi-C
... Could be. But What would be the advantage of such approach? ...
written 20 months ago by ancient_learner630
1
vote
0
answers
499
views
0
answers
Analysis pipeline for 3e Hi-C
... Hi I recently came across with [this paper][1] in which Chromatin was subsequently digested with three enzymes. According to my knowledge the restriction site is pretty much used in QC to obtain valid Hi-C pairs. But since, they have used 3 enzymes I am unable to find how they filtered the sequenc ...
hi-c 3e hi-c multi-enzyme digestion written 20 months ago by ancient_learner630
0
votes
0
answers
797
views
0
answers
Comment: C: Iterative trimming using bowtie
... Yeah. [GSE74912][1] [1]: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE74912 ...
written 20 months ago by ancient_learner630
0
votes
0
answers
797
views
0
answers
Comment: C: Iterative trimming using bowtie
... Yes. Thought I would grep them out after alignment. ...
written 20 months ago by ancient_learner630
0
votes
0
answers
797
views
0
answers
Comment: C: Iterative trimming using bowtie
... The reason I chose to do iterative mapping is after adapter trimming only 56% of the reads are getting Uniquely aligned to the reference genome. Where as around 10-15% are getting aligned to multiple locations. I thought If I could somehow retain those as well that would add up to my alignment perce ...
written 20 months ago by ancient_learner630

Latest awards to ancient_learner

Great Question 4 months ago, created a question with more than 5,000 views. For Bowtie --Very-Sensitive Option
Popular Question 19 months ago, created a question with more than 1,000 views. For Extracting The Features From Genbank File
Popular Question 19 months ago, created a question with more than 1,000 views. For Extract All Long Non-Coding Rna For Mouse
Popular Question 19 months ago, created a question with more than 1,000 views. For How To Show Gene-Gene Interactions On Linear Scale
Popular Question 19 months ago, created a question with more than 1,000 views. For Couldn'T Understand Re-Seeding Option In Bowtie2
Popular Question 19 months ago, created a question with more than 1,000 views. For Getting Promoter Sequences (2Kb Upstream From Gene)
Popular Question 2.1 years ago, created a question with more than 1,000 views. For Getting Promoter Sequences (2Kb Upstream From Gene)
Popular Question 2.1 years ago, created a question with more than 1,000 views. For Extracting The Features From Genbank File
Popular Question 2.2 years ago, created a question with more than 1,000 views. For Difference Between Chip-Seq And Biochip-Seq
Popular Question 2.3 years ago, created a question with more than 1,000 views. For Identifying Transcription Factor Binding Sites From Chip Seq
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Extracting The Features From Genbank File
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Getting Promoter Sequences (2Kb Upstream From Gene)
Popular Question 2.6 years ago, created a question with more than 1,000 views. For Difference Between Chip-Seq And Biochip-Seq
Popular Question 2.9 years ago, created a question with more than 1,000 views. For Getting Promoter Sequences (2Kb Upstream From Gene)
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Identifying Transcription Factor Binding Sites From Chip Seq
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Annotaion Based On The Genomic Range
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Extracting The Features From Genbank File
Popular Question 4.0 years ago, created a question with more than 1,000 views. For Extracting The Features From Genbank File
Popular Question 4.1 years ago, created a question with more than 1,000 views. For Extracting The Features From Genbank File
Popular Question 4.3 years ago, created a question with more than 1,000 views. For Getting Promoter Sequences (2Kb Upstream From Gene)
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Getting Promoter Sequences (2Kb Upstream From Gene)
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Extracting The Features From Genbank File
Popular Question 4.5 years ago, created a question with more than 1,000 views. For Working With Phastcons Files
Popular Question 4.6 years ago, created a question with more than 1,000 views. For How To Show Gene-Gene Interactions On Linear Scale
Popular Question 4.6 years ago, created a question with more than 1,000 views. For Extracting The Features From Genbank File

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1646 users visited in the last hour