User: jamie.pike

gravatar for jamie.pike
jamie.pike50
Reputation:
50
Status:
Trusted
Location:
Twitter:
@jamielpike56
Last seen:
18 hours ago
Joined:
5 months ago
Email:
j*********@warwick.ac.uk

Posts by jamie.pike

<prev • 50 results • page 1 of 5 • next >
0
votes
0
answers
46
views
0
answers
Comment: C: Visualise CD-HIT clusters?
... I was thinking something along the lines of a heatmap that is binary, if that makes sense? The protein clusters are from 9 genomes, 5 from one strain, 4 from another. I was hoping to try and create something that demonstrates a proteins presence in one strain and absence in another. I wasn't sure if ...
written 1 day ago by jamie.pike50
0
votes
0
answers
46
views
0
answers
Visualise CD-HIT clusters?
... I have recently clustered a set of proteins using CD-HIT and I was wondering if anyone could recommend a nice way to visualise the clusters (there are 61 clusters in total)? Example of clusters from CD-HIT: >Cluster 0 0 574aa, >GCA_000350365.1_Foc4_1.0_B2_genomic.fna_Candidate_Sequen ...
data visualisation clustering cd-hit written 1 day ago by jamie.pike50
0
votes
1
answer
88
views
1
answers
Comment: C: *** buffer overflow detected ***: blastclust terminated?? Is there another way t
... Works perfectly, thank you ...
written 1 day ago by jamie.pike50
2
votes
1
answer
88
views
1
answer
*** buffer overflow detected ***: blastclust terminated?? Is there another way to create a non-redundant set of proteins?
... I am trying to create a non-redundant set of proteins using blastclust, but I keep getting a buffer overflow error. Is anyone aware of a way to stop this, or can perhaps recommend an alternative program for creating non-redundant protein sets? There are currently 54 proteins in the FASTA. blastclu ...
1
vote
2
answers
130
views
2
answers
Comment: C: Python: regular expression searching error
... Thank you for clarifying. I have now removed the Bio.seq module from my code posted earlier, and it still works. I'm not sure what "fixed" it, but it appears I was way off! I shall certainly heed your advice and will try to familiarise my self with more of BioPythons modules. Thank you for all your ...
written 2 days ago by jamie.pike50
0
votes
2
answers
130
views
2
answers
Comment: C: Python: regular expression searching error
... Fantastic, thank you - that does exactly what I need. ...
written 2 days ago by jamie.pike50
0
votes
2
answers
130
views
2
answers
Comment: C: Python: regular expression searching error
... I have checked the output and it seems to be correct. I'm looking for a DNA transposon using the TIRs. So I would look for a single-stranded sequence of nucleotides (the regex) followed downstream by its reverse complement: "CAGTGGG..GCAA[TA]AA" and then downstream its reverse complement, "TT[TA]T ...
written 2 days ago by jamie.pike50
0
votes
2
answers
130
views
2
answers
Comment: C: Python: regular expression searching error
... I believe I have fixed it, but I have provided some sequences in case you may be able to improve it further. >Focub_II5_mimp_1__contig_1.16(656599:656809)_Does_no_contain_CAGTGGG..GCAA[TA]AA CGCAGGTGTGTAGAGAGATTTGTTGCTCGGAAGCTAGTTAGGTGTAGCTTGTCAGGTTCTCAGTACCCTATATTACACCGAGATCAGC ...
written 4 days ago by jamie.pike50
0
votes
2
answers
130
views
2
answers
Answer: A: Python: regular expression searching error
... I think fixed it!!! I believe the issue, was with how the sequence was being processed. When using BioPythons module `SeqIO` to provide the sequence for `re.search`, no reverse complement was identified. However, when I use the module `Bio.Seq` to search the sequences the reverse complements are fo ...
written 4 days ago by jamie.pike50
0
votes
2
answers
130
views
2
answers
Comment: C: Python: regular expression searching error
... I have now spotted that the code is: if hit and hit_rc: print(f'complete mimp found at {hit_rc.start()} to {hit_rc.end()}') and have changed it to: if hit and hit_rc: print(f'complete mimp found at {hit.start()} to {hit_rc.end()}') However the problem remain ...
written 4 days ago by jamie.pike50

Latest awards to jamie.pike

Supporter 1 day ago, voted at least 25 times.
Scholar 9 weeks ago, created an answer that has been accepted. For A: Bedtools intersect not reporting all overlaps

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 886 users visited in the last hour