User: kanwarjag

gravatar for kanwarjag
kanwarjag1.1k
Reputation:
1,050
Status:
Trusted
Location:
United States
Last seen:
3 days, 13 hours ago
Joined:
7 years, 10 months ago
Email:
k********@gmail.com

about me

Posts by kanwarjag

<prev • 378 results • page 1 of 38 • next >
0
votes
1
answer
44
views
1
answer
extracting count matrix from default cell ranger files
... I am looking for a non programmatic method or additional software that can make count matrix of genes from three file: barcode.tsv feature.tsv matrix.mtx Is there any tool or software? Thanks ...
rna-seq written 3 days ago by kanwarjag1.1k • updated 3 days ago by ATpoint40k
1
vote
1
answer
70
views
1
answer
merging bam from two samples
... Can I merge two bams from different samples (biological replicates) using simply cat command? ...
alignment written 11 days ago by kanwarjag1.1k • updated 11 days ago by genomax91k
0
votes
1
answer
109
views
1
answers
Comment: C: sparse peak calling
... The low read depths and background levels and broader peaks. ...
written 27 days ago by kanwarjag1.1k
0
votes
1
answer
109
views
1
answer
sparse peak calling
... I have a Chipseq data and I expects peaks should be sparse. Which tool may be best to call sparse peaks? Can I also use same tool for calling sparse peaks of cut and Run experiment. Thanks ...
chip-seq written 27 days ago by kanwarjag1.1k • updated 27 days ago by AS0
0
votes
0
answers
106
views
0
answers
SCRNA-seq experiment reads
... I am planning a 10X single cell RNAseq library preparation and sequencing in Nova seq. For human genome to look at standard differential expression and cell types, how many reads are required / sample. Is there any standard (not rare) rule of thumb how many cells should be sequenced. I have read 10 ...
rna-seq written 27 days ago by kanwarjag1.1k
0
votes
1
answer
105
views
1
answer
aligning 5' seq with - white list file
... I want to align 10x sequencing file with whitelist of barcode for quality checks. The reason I want to do is as running ranger or Starsolo does not extract any bar code. What should be the best approach to extract 28 bp from Fastq and find the part of sequence in whitelist? Thanks ...
alignment written 29 days ago by kanwarjag1.1k • updated 26 days ago by Kevin Blighe66k
0
votes
0
answers
127
views
0
answers
GTF/GFF3 file compatible with (GRCh38/hg38)(hg38)
... I am using Reference genome -Human Dec2013 (GRCh38/hg38)(hg38) and gene model Homo_sapiens.GRCh38.101.gff3.gz however I get error saying chromosome naming is not matching. I know that Ensembel uses Chr as prefix. The question is if I use Human Dec2013 (GRCh38/hg38)(hg38) as reference assembly, which ...
rna-seq written 29 days ago by kanwarjag1.1k
0
votes
0
answers
218
views
0
answers
Comment: C: STARsolo config for 10x Chromium v1, v2, v3
... Unfortunately https://singlecell.usegalaxy.eu/ it will not let me fine tune such parameters. ...
written 4 weeks ago by kanwarjag1.1k
0
votes
0
answers
218
views
0
answers
Comment: C: STARsolo config for 10x Chromium v1, v2, v3
... I got data for 10X processed in Nextseq. It uses Chromium Next GEM Single Cell 3' GEM, Library Kit v3.1 but has 27 bases in R1 reads- (CCTTTCAGTCGCATCGGAACCCACTGC) White list (Whitelist, 3M-Feb_2018_V3.txt) AAACCCAAGAAACACT I also tried version 2 and without Whitelist, but still, it will not work. ...
written 4 weeks ago by kanwarjag1.1k
2
votes
1
answer
174
views
1
answer
RNA-Seq Cell Barcode Whitelist 10X
... I am trying to get RNA-Seq Cell Barcode Whitelist for version 3 RNAseq of 10X. Is it a standard file Does any one know source of tis file outside cell ranger. ...
rna-seq written 4 weeks ago by kanwarjag1.1k • updated 4 weeks ago by ATpoint40k

Latest awards to kanwarjag

Great Question 6 weeks ago, created a question with more than 5,000 views. For GRCH38 and hg19
Epic Question 7 weeks ago, created a question with more than 10,000 views. For Converting Protein Names To Gene Ids
Popular Question 9 weeks ago, created a question with more than 1,000 views. For RPKM to FPKM conversion
Great Question 4 months ago, created a question with more than 5,000 views. For GRCH38 and hg19
Popular Question 4 months ago, created a question with more than 1,000 views. For RPKM to FPKM conversion
Popular Question 5 months ago, created a question with more than 1,000 views. For RPKM to FPKM conversion
Great Question 5 months ago, created a question with more than 5,000 views. For GRCH38 and hg19
Epic Question 6 months ago, created a question with more than 10,000 views. For Converting Protein Names To Gene Ids
Popular Question 8 months ago, created a question with more than 1,000 views. For ncRNA gencode files
Popular Question 8 months ago, created a question with more than 1,000 views. For ncRNA gencode files
Popular Question 9 months ago, created a question with more than 1,000 views. For TopHat and Fastq with different Lane numbers
Popular Question 9 months ago, created a question with more than 1,000 views. For ncRNA gencode files
Popular Question 10 months ago, created a question with more than 1,000 views. For ncRNA gencode files
Popular Question 10 months ago, created a question with more than 1,000 views. For ncRNA gencode files
Popular Question 11 months ago, created a question with more than 1,000 views. For ncRNA gencode files
Popular Question 12 months ago, created a question with more than 1,000 views. For RPKM to FPKM conversion
Popular Question 12 months ago, created a question with more than 1,000 views. For ncRNA gencode files
Popular Question 12 months ago, created a question with more than 1,000 views. For Is Genotype Info Must While Validating Mutations
Popular Question 13 months ago, created a question with more than 1,000 views. For Is Genotype Info Must While Validating Mutations
Popular Question 13 months ago, created a question with more than 1,000 views. For Is Genotype Info Must While Validating Mutations
Popular Question 15 months ago, created a question with more than 1,000 views. For log ratio in gene expression array
Popular Question 15 months ago, created a question with more than 1,000 views. For RPKM to FPKM conversion
Popular Question 15 months ago, created a question with more than 1,000 views. For ncRNA gencode files
Popular Question 15 months ago, created a question with more than 1,000 views. For Is Genotype Info Must While Validating Mutations
Great Question 15 months ago, created a question with more than 5,000 views. For GRCH38 and hg19

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 902 users visited in the last hour